<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1479-0556-3-1</ui>
   <ji>1479-0556</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Human cytomegalovirus plasmid-based amplicon vector system for gene therapy</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Mahmood</snm>
               <fnm>Kutubuddin</fnm>
               <insr iid="I1"/>
               <email>mahmoodk@medimmune.com</email>
            </au>
            <au id="A2">
               <snm>Prichard</snm>
               <mi>N</mi>
               <fnm>Mark</fnm>
               <insr iid="I1"/>
               <email>mprichard@peds.uab.edu</email>
            </au>
            <au id="A3">
               <snm>Duke</snm>
               <mi>M</mi>
               <fnm>Gregory</fnm>
               <insr iid="I1"/>
               <email>dukeg@medimmune.com</email>
            </au>
            <au id="A4">
               <snm>Kemble</snm>
               <mi>W</mi>
               <fnm>George</fnm>
               <insr iid="I1"/>
               <email>kembleg@medimmune.com</email>
            </au>
            <au id="A5" ca="yes">
               <snm>Spaete</snm>
               <mi>R</mi>
               <fnm>Richard</fnm>
               <insr iid="I1"/>
               <email>spaeter@medimmune.com</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>MedImmune Vaccines Inc., 297 North Bernardo Avenue, Mountain View, CA 94043 USA</p>
            </ins>
         </insg>
         <source>Genetic Vaccines and Therapy</source>
         <issn>1479-0556</issn>
         <pubdate>2005</pubdate>
         <volume>3</volume>
         <issue>1</issue>
         <fpage>1</fpage>
         <url>http://www.gvt-journal.com/content/3/1/1</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">15673469</pubid>
               <pubid idtype="doi">10.1186/1479-0556-3-1</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>28</day>
               <month>8</month>
               <year>2004</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>26</day>
               <month>1</month>
               <year>2005</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>26</day>
               <month>1</month>
               <year>2005</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2005</year>
         <collab>Mahmood et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <p>We have constructed and evaluated the utility of a helper-dependent virus vector system that is derived from Human Cytomegalovirus (HCMV). This vector is based on the herpes simplex virus (HSV) amplicon system and contains the HCMV orthologs of the two <it>cis</it>-acting functions required for replication and packaging of HSV genomes, the complex HCMV viral DNA replication origin (oriLyt), and the cleavage packaging signal (the <it>a </it>sequence). The HCMV amplicon vector replicated independently and was packaged into infectious virions in the presence of helper virus. This vector is capable of delivering and expressing foreign genes in infected cells including progenitor cells such as human CD34+ cells. Packaged defective viral genomes were passaged serially in fibroblasts and could be detected at passage 3; however, the copy number appeared to diminish upon serial passage. The HCMV amplicon offers an alternative vector strategy useful for gene(s) delivery to cells of the hematopoietic lineage.</p>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>HCMV is a member of the betaherpesvirus family <abbrgrp><abbr bid="B42">42</abbr><abbr bid="B48">48</abbr></abbrgrp>. Other members of this family include human herpesvirus 6 (HHV-6), and human herpesvirus 7 (HHV-7), and all are widely distributed in human populations. During productive replication, the 230 kilobase pair (kbp) viral genome replicates by a rolling circle mechanism, which generates long head-to-tail concatemers that are cleaved to unit length and packaged in capsids. The state of the HCMV genome during latency remains unidentified and is likely to be circular and extrachromosomal <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. The HCMV genome has been detected in cells within the hematopoietic lineage as early as CD34+ progenitors and up through differentiated macrophages <abbrgrp><abbr bid="B23">23</abbr><abbr bid="B29">29</abbr><abbr bid="B38">38</abbr><abbr bid="B54">54</abbr></abbrgrp>.</p>
         <p>Defective HSV viruses created by high multiplicity serial passage of virus stocks have been described on numerous occasions and have been characterized in detail at the molecular level <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B18">18</abbr><abbr bid="B31">31</abbr><abbr bid="B43">43</abbr><abbr bid="B52">52</abbr><abbr bid="B67">67</abbr></abbrgrp>. Naturally occurring defective HSV viruses and laboratory derived HSV amplicon vectors are composed of head-to-tail tandem reiterations of subgenomic regions containing a functional origin of DNA replication (Ori<sub>S</sub>or Ori<sub>L</sub>) and a DNA cleavage/packaging signal <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B30">30</abbr><abbr bid="B57">57</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr><abbr bid="B62">62</abbr></abbrgrp>. These two <it>cis</it>-acting functions can be relatively small ranging from <it>ca</it>. 90&#8211;150 base pairs (bp) for the ori and <it>ca</it>. 250&#8211;300 bp for the <it>a </it>sequence. The functional HCMV oriLyt is much more complex than either of the HSV oris; the HCMV oriLyt consists of multiple direct and inverted repeats and extends over at least 1500 bp <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B24">24</abbr><abbr bid="B37">37</abbr></abbrgrp>. HCMV is unique among the herpesviruses in not having an origin binding protein homolog that is required for DNA replication <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. The HCMV <it>a </it>sequence varies in size from <it>ca</it>. 550 bp to 762 bp, however, the conserved pac-1 and pac-2 <it>cis</it>-elements which determine the sites for cleavage of replicated viral DNA are present <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B28">28</abbr><abbr bid="B58">58</abbr><abbr bid="B64">64</abbr><abbr bid="B65">65</abbr></abbrgrp>.</p>
         <p>In contrast to HSV, HCMV does not efficiently produce defective virus genomes, this difference may be related to the distinct biology of the two viruses <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. However two reports described the identification of what may potentially be HCMV defective viruses created by serial high multiplicity passage <abbrgrp><abbr bid="B47">47</abbr><abbr bid="B59">59</abbr></abbrgrp>. These reports characterized HCMV defectives as very large subgenomic DNA molecules, in some cases extending over two thirds of the genome. In addition to these replication defective HCMV viruses, a recent report by Borst <it>et al</it>. 2003 <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, described the construction of an HCMV amplicon. In this report we further utilized the HCMV amplicon for gene delivery to human CD34+ cells.</p>
         <p>HCMV infects cells of the hematopoietic lineage <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B55">55</abbr><abbr bid="B68">68</abbr></abbrgrp>. Viral genomes can be found in CD34+ cells from seropositive individuals and granulocyte-macrophage progenitors and differentiated macrophages can be infected experimentally <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. We were interested in determining whether the tropism of HCMV can be exploited to construct defective HCMV virus vectors (amplicons) targeted to hematopoietic stem cells. The general feasibility of such an approach for other cell types has been shown using other herpesviruses, e.g. HSV, EBV, and HHV-7 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr><abbr bid="B30">30</abbr><abbr bid="B35">35</abbr><abbr bid="B49">49</abbr><abbr bid="B70">70</abbr><abbr bid="B71">71</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Cells and virus</p>
            </st>
            <p>HCMV Toledo (passage 8, from Dr. S. Plotkin, Aventis Pasteur, Doylestown, PA), and HCMV Towne<it>var</it>RIT (passage 134, from Dr. Plotkin via Dr. Ed Mocarski, Stanford University), were propagated in human fibroblasts (HF) cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (JRH Biosciences, Lenexa, Kans.). Recombinant HCMV, RC2.7EGFP, expressing enhanced green fluorescent protein (EGFP) (Clonetech, Palo Alto, CA), under the control of the major early 2.7 promoter, was constructed by cotransfection of plasmid pEAG2.7EGFP with a set of overlapping cosmid clones derived from HCMV Toledo (G.M. Duke, unpublished data).</p>
         </sec>
         <sec>
            <st>
               <p>Plasmid constructions</p>
            </st>
            <p>Plasmid pON205 (Spaete and Mocarski, 1985), contains the Towne strain <it>a </it>sequence, was obtained from Ed Mocarski (Stanford University). pEAG2.7EGFP was derived by cloning the EGFP gene from plasmid pEGFP-N2 (Clonetech, Palo Alto, CA) between the <it>Eag</it>I and <it>Sma</it>I site of the &#946;2.7 gene taken from Toledo (G.M. Duke, unpublished data). HCMV amplicon plasmid Tn9-8 was derived by inserting the 6 kpb <it>Dra</it>I fragment of Towne<it>var</it>RIT (corresponding to nucleotides 91,166 &#8211; 95,909 relative to AD169) (Figure <figr fid="F1">1B</figr>), spanning the HCMV oriLyt into the <it>Eco</it>RI site of pON205. Tn9-8 was partially sequenced by single-cycle and multicycle dideoxy-nucleotide chain termination method of Sanger <it>et al</it>., <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>. The plasmids designated Tn9-8GF5 and Tn9-8GF7 incorporating the EGFP gene with the HCMV Major Immediate Early (MIE) promoter and SV40 poly A sequence was isolated as a 2,334 bp <it>Nsi</it>I fragment from plasmid pEGFP-N2 (Clonetech, Palo Alto, CA), and cloned into the HCMV amplicon Tn9-8 at the <it>Pst</it>I site in both orientations. The <it>gpt </it>gene in Tn9-8-<it>gpt </it>was derived by cloning a PCR fragment from <it>Escherichia coli </it>DH5&#945; using the primer pairs 5'CTGCAGCTAGTCTAGACTGGGACACTTCACATGAGC3'and 5'CTGCAGCTATGTATCTAGAGCCAGGCGTTGAAAAGATTA3'.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Schematic representation of amplified region near <it>ori</it>Lyt of the HCMV genome</p>
               </caption>
               <text>
                  <p>Schematic representation of amplified region near <it>ori</it>Lyt of the HCMV genome. <b>A</b>. Restriction enzyme map of minimal <it>ori</it>Lyt and adjacent region of heterogeneity (block). <b>B</b>. Region of heterogeneity shown as a dimer. Arrow indicates junction of the repeat segment. The number 91,166 to the left of the restriction map corresponds to the nucleotide position of the AD169 genome (EMBL accession number X17403). <b>C</b>. Autoradiograph of Southern blot utilizing a minimal <it>ori</it>Lyt probe, pON2623 (Kemble et al., 1996). Monomers and dimers are depicted with one and two arrows, respectively. Trimers and tetramers can be seen in the Towne<it>var</it>RIT viral stock.</p>
               </text>
               <graphic file="1479-0556-3-1-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Generation of viral stocks containing amplicons</p>
            </st>
            <p>Plasmid DNA was transfected by CaPO<sub>4 </sub>precipitation of approximately 4 &#956;g of Tn9-8 amplicon DNA. The Tn9-8 DNA was transfected into approximately 1 &#215; 10<sup>6 </sup>passage 16 human fibroblast (HF) cells. At 24 hours post transfection, the cells were infected with CMV Towne at a multiplicity of infection (MOI) of 5 plaque forming units (PFU) per cell. Fresh medium was added to cells four days after infection and cells were harvested at 6 to 7 days post infection as described previously (Spaete and Frenkel, 1982). Virus stocks are prepared by three freeze-thaw cycles. Serial passages of amplicon-containing viral stocks on fresh HF cells were superinfected with CMV Towne as a helper virus at a MOI of 1.</p>
         </sec>
         <sec>
            <st>
               <p>Southern blot analysis</p>
            </st>
            <p>Viral DNAs were digested with restriction enzyme, electrophoresed in 0.8% agarose gels, transferred to Hybond-N+ nylon membranes (Amersham Corp.), (Maniatis et al., 1989), and immobilized with a UV Crosslinker 1000 (Hoefer Scientific Instruments, San Francisco, CA). DNA on the membrane was probed with fluorescein-labeled pUC9 DNA using conditions previously described (Spaete and Mocarski, 1985).</p>
         </sec>
         <sec>
            <st>
               <p>Isolation of CD34<sup>+ </sup>cells and infection with CMV</p>
            </st>
            <p>The isolation of cord blood CD34+ stem cells was carried out by All Cells Inc. (Berkeley, CA) using CD34 Progenitor Cell Isolation Kit (Miltenyi Biotech, Auburn, CA). The positive selection of the CD34+ cells was carried out using hapten-conjugated antibody to CD34+ followed by anti-hapten antibody coupled to MACS Microbeads. The magnetically labeled cells are enriched on positive selection columns in the magnetic field. The purity of the CD34+ population was >95% as analyzed by flow cytometry. The purified CD34+ cells were suspended in Iscove's modified Dulbecco's Minimal Essential Medium containing 5% fetal bovine serum. 2 &#215; 10<sup>5 </sup>CD34+ cells were used for each infection with TN9-8GF5 amplicon containing stocks, RC2.7EGFP virus, CMV Towne virus, or uninfected cell control. The cells mixed with virus were centrifuged at 500 &#215; g for 10 mins at room temperature and were then placed in 37&#176;C water bath for one hour. Following this the cells were cultured in 6-well cell culture plates (Costar) for 18&#8211;72 hours. At the end of the incubation the cells were harvested for CD34 staining.</p>
         </sec>
         <sec>
            <st>
               <p>EGFP expression and immunostaining for flow cytometric analysis</p>
            </st>
            <p>Amplicon containing viral stocks prepared from passage 1 were used to infect HF or human CD34+ cells maintained in 12 well culture plates. At 24 hour intervals post infection, the wells were observed for EGFP expression with a Nikon TE2000 microscope under UV illumination. Immunostaining for CD34+ cells was done using Phycoerythrin (PE)-conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA). Infected or control cells were incubated with 20 &#956;l of PE-labeled anti-CD34 antibody for 45 minutes at room temperature and subsequently were washed twice with PBS containing 0.1% BSA. The cells were directly analyzed for EGFP and CD34+ staining on a FACSCalibur instrument (Becton Dickinson, San Jose, CA), at 18 and 36 hours post infection.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>In order to exploit the natural tropism of HCMV for cells of the hematopoietic lineage, in a nonlytic manner, an HCMV amplicon i.e. a plasmid containing the HCMV oriLyt and <it>a </it>sequences was constructed. Theoretically, due to the large size of the HCMV genome, an amplicon derived from this virus should be able to carry the large DNA inserts and be capable of efficient introduction into hematopoietic cells by infection.</p>
         <sec>
            <st>
               <p>Heterogeneity at oriLyt</p>
            </st>
            <p>During analysis of cosmid clones of HCMV strain Towne, sequence heterogeneity was observed in the <it>Eco</it>RI E fragment of Towne that was not present in the Toledo strain <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>. The <it>Eco</it>RI E region spans in part the complex oriLyt region <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr><abbr bid="B24">24</abbr><abbr bid="B37">37</abbr></abbrgrp>. Sequences in a 1.2 kbp repeat fragment were shown to give rise to the heterogeneity observed at this locus in the Towne genome (Figure <figr fid="F1">1</figr>). The coordinates of a single repeat unit starts at nucleotide 94,561 relative to the AD169 sequence and end at nucleotide 95,807 <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>. This segment can repeat at least three times in Towne strains from different passage histories (Fig. <figr fid="F1">1</figr>). This heterogeneity is different from the 189 bp repeat region previously described for the Towne strain oriLyt which occurs near the <it>Bam</it>HI sites in Figure <figr fid="F1">1</figr> (nt 93337&#8211;93525 relative to AD169), <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. Since Towne replicates to relatively high titers in cell culture, it was deemed advantageous to incorporate this heterogeneity in the origin containing sequences to be used in the amplicon construct.</p>
         </sec>
         <sec>
            <st>
               <p>Construction of the HCMV amplicon</p>
            </st>
            <p>As a test of the feasibility of the system, an HCMV amplicon was constructed which incorporated the two <it>cis</it>-acting functions required for the propagation of the defective virus genomes in the presence of helper virus (Figure <figr fid="F2">2</figr>). HCMV amplicon plasmid Tn9-8 was derived by inserting the 6 kpb <it>Dra</it>I fragment of Towne (corresponding to nucleotides 91,166&#8211;95,909 relative to AD169) <abbrgrp><abbr bid="B10">10</abbr></abbrgrp> (Figure <figr fid="F1">1B</figr>), spanning the HCMV oriLyt into the <it>Eco</it>RI site of pON205. The resulting amplicon was designated Tn9-8 (Figure <figr fid="F2">2</figr>), and was partially sequenced to verify its structure.</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Schematic representation of the HCMV amplicon plasmids Tn9-8<it>gpt</it>, Tn9-8GF7 and Tn9-8GF5</p>
               </caption>
               <text>
                  <p>Schematic representation of the HCMV amplicon plasmids Tn9-8<it>gpt</it>, Tn9-8GF7 and Tn9-8GF5. The EGFP expression cassette was cloned in two orientations in the unique <it>Pst</it>I site in Tn9-8. The <it>gpt </it>expression cassette was cloned between the unique <it>Pst</it>I and <it>Hind</it>III sites.</p>
               </text>
               <graphic file="1479-0556-3-1-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Generation of viral stocks containing amplicons</p>
            </st>
            <p>As a test of the ability of this construct to function as an amplicon, plasmid Tn9-8 was transfected in human fibroblast (HF) cells, and subsequently infected with HCMV Towne strain at an MOI of 5 to provide helper virus replication functions. Seven days later, infected cells were harvested, sonicated, and viral stocks were prepared for passage to fresh HF cells. Fresh HF cells were infected with the progeny of the transfection/infection and incubated for 7 days. The DNA from these infected cells was harvested (designated passage 1), restricted with <it>Hind</it>III and <it>Dpn</it>I, and Southern blotted <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Southern blot analyses of DNA demonstrated that Tn9-8 was susceptible to digestion with <it>Dpn</it>I, consistent with replication of the plasmid in bacteria (Figure <figr fid="F3">3</figr>, lane 2). In contrast, Tn9-8 in infected cells was resistant to <it>Dpn</it>I demonstrating that it had replicated in eucaryotic cells (Figure <figr fid="F3">3</figr>, lanes 3&#8211;5). This observation is consistent with replication and packaging of Tn9-8 into infectious virions. These results demonstrate that foreign DNA sequences, exemplified by the plasmid pUC9, can be introduced into defective genomes that are packaged and propagated in serially passaged virus stocks. To examine whether these results were the consequence of amplicon replication and packaging or integration of the amplicon plasmid into the helper virus, DNA prepared from passage 1 infected cells was digested with <it>Cla </it>I, <it>Xba </it>I, <it>Afl </it>II and <it>Dpn </it>I. These enzymes digested the Towne helper virus DNA to fragments no larger than 13.6 kbp but do not cut within Tn9-8. The amplicon DNA was significantly larger than 23 kbp consistent with the amplicon being replicated as a concatamer (Figure <figr fid="F4">4</figr>). This result indicated that the high molecular weight DNA containing plasmid sequences was packaged independently and was not integrated into helper virus.</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Southern blot analysis of passage 1 of HCMV amplicon DNA probed with plasmid pUC9</p>
               </caption>
               <text>
                  <p>Southern blot analysis of passage 1 of HCMV amplicon DNA probed with plasmid pUC9. Lane 1. Plasmid Tn9-8 linearized with <it>Hind </it>III serves as a marker for correct migration of monomeric repeats. Lane 2. Plasmid Tn9-8 restricted with <it>Hind </it>III and <it>Dpn </it>I as a control for non-replicating DNA. Lanes 3&#8211;5. Infected cell DNAs restricted with <it>Hind </it>III and <it>Dpn </it>I. The signal in lanes 3&#8211;5 (arrow) demonstrates authentic replication and packaging of amplicon Tn9-8 in eucaryotic cells.</p>
               </text>
               <graphic file="1479-0556-3-1-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Southern blot analysis of high molecular weight HCMV amplicon DNA at passage 1 probed with plasmid pUC9</p>
               </caption>
               <text>
                  <p>Southern blot analysis of high molecular weight HCMV amplicon DNA at passage 1 probed with plasmid pUC9. DNA prepared from passage 1 infected cells was digested with <it>Cla </it>I, <it>Xba </it>I, <it>Afl </it>II and <it>Dpn </it>I, Southern blotted and probed with plasmid pUC9. The samples are from those shown in Fig. 3, lanes 3 and 5. The high molecular weight DNA containing plasmid sequences (arrow) demonstrates the major hybridizing species migrating slower than the 23 kbp lambda DNA <it>Hind </it>III digest indicated as the marker on the left of the autoradiograph.</p>
               </text>
               <graphic file="1479-0556-3-1-4"/>
            </fig>
            <p>Packaged defective viral genomes derived from Tn9-8 or a derivative containing a selectable marker (Tn9-8-<it>gpt</it>), were serially passaged in HF cells. Defective viruses could be detected at passage 3 when probed with plasmid pUC9; however, the copy number appeared to diminish upon serial passage (not shown). Selection with mycophenolic acid on Tn9-8-<it>gpt </it>amplicons did not enhance recovery.</p>
         </sec>
         <sec>
            <st>
               <p>Rescue of monomeric repeat units in bacteria</p>
            </st>
            <p>Concatemeric DNA was prepared from passage 2 and 3 virus stocks containing the defective virus genomes (Tn9-8-<it>gpt</it>), digested with <it>Pst </it>I and <it>Hind </it>III, respectively, in order to analyze monomeric repeat units. The <it>Hind </it>III-digested DNA was circularized by ligation and used to transform <it>E. coli </it>bacteria to analyze structure and to demonstrate shuttle vector capability between eucaryotic and bacterial hosts. A number of plasmids prepared from the rescue attempt had a restriction enzyme pattern indistinguishable from the input (Fig. <figr fid="F5">5A</figr>, lanes 1 and 2). Other plasmids however exhibited the expected restriction pattern consistent with a head-to-tail amplification of the <it>a </it>sequence (lanes 3 and 4). Digestion with <it>Nae</it>I produced a fragment of the predicted size of a unit length <it>a </it>sequence (762 bp), and this product hybridized with an <it>a </it>sequence specific probe (<it>Pst</it>I-<it>Sgr</it>AI fragment from Tn9-8), (Figs. <figr fid="F2">2</figr> and <figr fid="F5">5B</figr>, lanes 3 and 4). This type of amplification has been readily seen in restriction enzyme digested DNA preparations of parental genomes of both HSV and HCMV <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr><abbr bid="B58">58</abbr><abbr bid="B64">64</abbr><abbr bid="B69">69</abbr></abbrgrp> and has also been observed in HSV amplicons using Southern blot hybridizations <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Tn9-8-<it>gpt </it>was rescued from concatamers following serial passage in HF cells</p>
               </caption>
               <text>
                  <p>Tn9-8-<it>gpt </it>was rescued from concatamers following serial passage in HF cells. (A) Tn9-8-<it>gpt </it>was passaged in HF cells and monomer units were recovered by linearizing concatemeric DNA from serial passage 3 with <it>Hind</it>III and cloning in bacteria (lanes 2 and 4) and also by linearizing passage 2 DNA with <it>Pst</it>I and cloning in bacteria (lane 3). Lane 1 represents the unpassaged clone for comparison. Following rescue in bacteria, DNA was prepared and cut with <it>Nco</it>I. Fragments were separated on an agarose gel and visualized with ethidium bromide staining (left panel). The gel was transferred to a nylon membrane and probed with an <it>a </it>sequence specific probe (right panel). (B) Fragments from an <it>Nae</it>I digest were also separated on an agarose gel and visualized as in panel A. The gel was transferred to a nylon membrane and probed with an <it>a </it>sequence specific probe. Lane 5 shows a 100 bp ladder. Lanes 3 and 4 show a <it>ca</it>. 800 bp fragment that hybridizes to <it>a </it>sequences.</p>
               </text>
               <graphic file="1479-0556-3-1-5"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Expression of heterologous genes in an HCMV amplicon</p>
            </st>
            <p>To demonstrate that the HCMV amplicon could be used as a vector system to support the expression of a foreign gene, EGFP under the transcriptional control of the HCMV major immediate early (MIE) promoter was used as test reporter gene. Two resulting amplicon plasmids designated Tn9-8GF5 and Tn9-8GF7 both expressed EGFP following transfection of HF cells in the absence of helper virus, as expected (not shown). Packaged amplicons were generated by introduction of Tn9-8GF5 into cells and infecting with HCMV 24 hours later at an MOI of 5. Transfection-derived viral stocks were passaged onto fresh HF cells supplemented with Towne helper virus at an MOI of 1. Viral stocks prepared from passage 1 were used to infect HF cells and grown on 12-well tissue culture plates. A limited number (ca. 0. 1%) of brightly fluorescing cells could be seen by microscopic examination at 24, 72 and 96 hours post-infection (Figure <figr fid="F6">6</figr>). This demonstrates that a foreign gene can be expressed in the context of a HCMV amplicon viral stock in infected HF cells.</p>
            <fig id="F6">
               <title>
                  <p>Figure 6</p>
               </title>
               <caption>
                  <p>Fluorescent Microscopic Analysis of TN9-8GF5 amplicon infected cells</p>
               </caption>
               <text>
                  <p>Fluorescent Microscopic Analysis of TN9-8GF5 amplicon infected cells. Human fibroblast cells (HF) or human cord blood CD34<sup>+ </sup>cells were infected with TN9-8GF5 amplicon-containing stocks, or mock infected. Cells were observed at different time-points 24, 72 and 96 hrs post infection with TN9-8GF5 amplicon under the fluorescent microscope (Nikon TE2000 microscope). EGFP expressing fluorescent cells were observed in the TN9-8GF5 amplicon infected human fibroblast cells or human CD34+ cells at different time-points. Control uninfected cells were negative (not shown).</p>
               </text>
               <graphic file="1479-0556-3-1-6"/>
            </fig>
            <p>To test the utility of the HCMV amplicon in gene therapy or gene delivery, we used packaged amplicons in viral stocks to infect and deliver an expressed gene into human CD34+ progenitor cells. Viral stocks containing amplicons carrying EGFP under the transcriptional control of the HCMV major immediate early (MIE) promoter prepared from passage 0 and passage 1 were used to infect CD34+ cells derived from cord blood. Starting at 24 h after infection, CD34+ cells were examined for EGFP expression by fluorescent microscopy. EGFP expression was observed in TN9-8GF5 amplicon-infected CD34+ cells starting at 24 h post-infection. The cells remained positive for EGFP expression for more than 96 hrs, at which point the cells were terminated (Figure <figr fid="F6">6</figr>).</p>
            <p>In a separate experiment, at 36 hours post infection, the cells were stained with PE-labeled anti-CD34 and analyzed for the CD34 marker and EGFP expression. EGFP expression was observed in the CD34+ population in the TN9-8GF5 amplicon (0.3%, 0.1%) (Figure <figr fid="F7">7a</figr>, &amp;<figr fid="F7">7b</figr>) or the CMV-EGFP virus (0.6%) (Figure <figr fid="F7">7c</figr>) at 36 hours post infection. The CMV Towne control-virus infected cells or uninfected CD34+ cell control were negative for EGFP expression (Figure <figr fid="F7">7d</figr>, &amp;<figr fid="F7">7e</figr>). A small population (7&#8211;12%) of the cells lost expression of the CD34+ marker upon <it>in vitro </it>culture. EGFP expression was also observed in a CD34(-) population infected with either TN9-8GF5 amplicon containing viral stocks (0.8%, 0.1%) or with the CMV-EGFP virus, RC2.7EGFP (3.6%) (Figure <figr fid="F7">7a, 7b</figr> &amp;<figr fid="F7">7c</figr>). The CMV Towne infected cells or uninfected control cell also had a significant CD34 negative population but were negative for EGFP expression (Figure <figr fid="F7">7d</figr>, and <figr fid="F7">7e</figr>). These results clearly demonstrate that CD34+ cells can be infected with replication competent or incompetent CMV vectors expressing a foreign gene.</p>
            <fig id="F7">
               <title>
                  <p>Figure 7</p>
               </title>
               <caption>
                  <p>Flow cytometry analysis of human cord blood CD34<sup>+ </sup>cells infected with CMV amplicon containing stocks, virus, or uninfected cell control</p>
               </caption>
               <text>
                  <p>Flow cytometry analysis of human cord blood CD34<sup>+ </sup>cells infected with CMV amplicon containing stocks, virus, or uninfected cell control. TN9-8GF5 amplicon (<it>a,b</it>), CMV-EGFP (RC2.7EGFP) virus (<it>c</it>), CMV (Towne) infected (<it>d</it>), or control uninfected human cord blood CD34 cells (<it>e,f</it>), were stained 36 hours post-infection with PE-antiCD34 antibody (<it>a-e</it>), or were left unstained (<it>f</it>), and were analyzed for two-color cytometry analysis using a FACS Calibur instrument. The dot-plots are generated using Cell Quest software and reveal the EGFP<sup>+ </sup>cells populations. Numbers in the upper right and lower right quadrants indicate percentage of the EGFP<sup>+</sup>CD34<sup>+ </sup>and EGFP<sup>+</sup>CD34<sup>- </sup>cells respectively. A frequency lower than 0.01% is considered negative.</p>
               </text>
               <graphic file="1479-0556-3-1-7"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Conclusions</p>
         </st>
         <p>We have shown that a replication-defective virus vector system that is derived from HCMV is capable of delivering and expressing foreign genes in infected primary cells including progenitor stem cells such as human CD34+ cells. Further improvement and optimization of the system offers the potential to deliver gene-based therapies to multipotent cells.</p>
         <sec>
            <st>
               <p>Advantages for use of the HCMV amplicon</p>
            </st>
            <p>Foremost among the advantages of the vector system we have described is the potential ability to efficiently infect and deliver genetic information to hematopoietic stem cells (CD34+) and other dividing and non-dividing cell types which may support HCMV infection <abbrgrp><abbr bid="B34">34</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr><abbr bid="B55">55</abbr><abbr bid="B68">68</abbr></abbrgrp>. Genetic hematological disorders such as thalassemias and sickle-cell anemia and other hemaglobinopathies could therefore be targeted for therapy with this strategy. Another potential advantage for the system is that vector DNA could possibly be maintained as an episome with minimal concern for the potential consequences of random integration of vector DNA (i.e. activation of oncogenes or inactivation of tumor suppressor genes). In order to insure efficient segregation as an episome, the EBV latent replication origin, oriP, and the transactivator, EBNA-1, could be added as was previously shown for another hybrid herpesvirus vector <abbrgrp><abbr bid="B71">71</abbr></abbrgrp>. However such a modification may not be necessary because HCMV genomes appear to be carried continuously in cells of hematopoietic origin in infected individuals. Yet another potential advantage as with other herpesviral vectors, is that the HCMV vector system should have the capacity for very large inserts.</p>
         </sec>
         <sec>
            <st>
               <p>Infection of CD34+ cells with HCMV</p>
            </st>
            <p>The infectivity of CD34+ cells from seropositive and seronegative subjects with HCMV has been tested both <it>in vivo </it>and <it>in vitro </it><abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. Furthermore, hematopoietic stem cells are also reported as a site for HCMV latency. Efficient transduction of human CD34+ cells with retroviral and non-viral vectors has been unsatisfactory due to the lack of maintenance of high levels of expression of the transgene following engraftment of the engineered cells <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. The HCMV MIE promoter may not be the right promoter for optimal expression in a CD34+ cells, since it has been shown that in the context of a lentiviral-based gene transfer system this promoter appeared to function less efficiently due to a cell-type specific expression defect <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. The approaches to improving the efficiency of gene transfer into human cells have focused on improving gene delivery vectors and optimizing <it>ex vivo </it>culture conditions, which preserve the developmental properties of the stem cells <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B22">22</abbr></abbrgrp>. Umbilical cord blood is recognized as a rich source of hematopoietic CD34+ stem cells <abbrgrp><abbr bid="B33">33</abbr></abbrgrp>. In our experiments we used cord blood derived CD34+ cells for infection with HCMV amplicon containing stocks or HCMV-EGFP virus. However, bone marrow derived CD34+ cells have also been shown to be infectable <it>in vitro </it>with HCMV <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. Gentry &amp; Smith <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>, reported a progressive loss of primitive cell properties including a reduction of CD34 expression upon <it>in vitro </it>culture of cord blood derived CD34+ cells. In a separate study, cord blood derived CD34+ cells cultured with IL-3 <it>in vitro </it>showed a progressive decline of the CD34+ population and more differentiated cells originating in the CD34(-) population <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>. In our experiments with >95% pure cord blood derived CD34+ cell population, a loss of CD34 expression in a small percent population (9&#8211;12%) of stem cells upon <it>in vitro </it>culture has been observed. EGFP expression was also seen in the CD34(-) population (Fig <figr fid="F7">7a, 7b</figr>, &amp;<figr fid="F7">7c</figr>). It is possible that HCMV infection of CD34 cells could induce cell differentiation and loss of primitive properties including reduction of CD34 expression.</p>
            <p>Further studies of HCMV infection in CD34 cells will help in defining whether CD34+ infected cells undergo cell differentiation by increased expression of other markers such as CD33, CD38, HLA-DR or cytokines. It is also relevant to note here that HCMV virus carries homolog sequences for HLA-related and cytokine-related molecules and infection can induce cellular cytokines <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B8">8</abbr><abbr bid="B19">19</abbr><abbr bid="B32">32</abbr><abbr bid="B44">44</abbr><abbr bid="B46">46</abbr><abbr bid="B50">50</abbr><abbr bid="B66">66</abbr></abbrgrp>. The HCMV amplicons contain only the <it>cis</it>-acting ori and packaging sequences, and have no structural gene sequences. However, amplicon containing viral stocks are a mixture with HCMV replication competent helper virus. HCMV induced cell-differentiating effect, if any, might be minimized using a helper virus-free amplicon system. In this regard, it should be possible to test a number of strategies to prepare helper virus-free stocks <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B63">63</abbr></abbrgrp>. These preparations would be useful for therapeutic applications in immuno-compromised patients.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Competing Interests</p>
         </st>
         <p>The authors of this publication are supported financially by salary and shares of MedImmune Inc., during the completion of this work. A patent application has been filed with the United States Patent Office relating to the content of this manuscript. The authors have assigned all rights of ownership to MedImmune Inc. The authors declare that they have no other competing interest.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' Contributions</p>
         </st>
         <p>KM carried out the expression analysis in human fibroblasts and CD34 cells. MNP &amp; GMD generated amplicon stocks and MNP did the '<it>a</it>' sequence analysis. GWK provided critical intellectual input. RRS provided the original idea and experimental design as well as cloning of the amplicon, generation of amplicon stocks and Southern analysis.</p>
      </sec>
   </bdy>
   <bm>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Boundaries and structure of human cytomegalovirus <it>ori</it>Lyt, a complex origin for lytic-phase DNA replication</p>
            </title>
            <aug>
               <au>
                  <snm>Anders</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Kacica</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Pari</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Punturieri</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1992</pubdate>
            <volume>66</volume>
            <fpage>3373</fpage>
            <lpage>3384</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">241117</pubid>
                  <pubid idtype="pmpid">1316454</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Multicomponent origin of cytomegalovirus lytic-phase DNA replication</p>
            </title>
            <aug>
               <au>
                  <snm>Anders</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Punturieri</snm>
                  <fnm>SM</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1991</pubdate>
            <volume>65</volume>
            <fpage>931</fpage>
            <lpage>937</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">239834</pubid>
                  <pubid idtype="pmpid">1846206</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Class I defective herpes simplex virus DNA as a molecular cloning vehicle in eucaryotic cells</p>
            </title>
            <aug>
               <au>
                  <snm>Barnett</snm>
                  <fnm>JW</fnm>
               </au>
               <au>
                  <snm>Eppstein</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>HW</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1983</pubdate>
            <volume>48</volume>
            <fpage>384</fpage>
            <lpage>95</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">255363</pubid>
                  <pubid idtype="pmpid">6312096</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Analysis of two potential shuttle vectors containing herpes simplex virus defective DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Bear</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Colberg-Poley</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Court</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Carter</snm>
                  <fnm>BJ</fnm>
               </au>
               <au>
                  <snm>Enquist</snm>
                  <fnm>LW</fnm>
               </au>
            </aug>
            <source>J Mol Appl Genet</source>
            <pubdate>1984</pubdate>
            <volume>2</volume>
            <fpage>471</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6090565</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>An HCMV reading frame which has similarity with both the V and C regions of the TCR gamma chain</p>
            </title>
            <aug>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Barrell</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>DNA Seq</source>
            <pubdate>1991</pubdate>
            <volume>2</volume>
            <fpage>33</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1666312</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Peripheral blood CD14(+) cells from healthy subjects carry a circular conformation of latent cytomegalovirus genome</p>
            </title>
            <aug>
               <au>
                  <snm>Bolovan-Fritts</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Wiedeman</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1999</pubdate>
            <volume>93</volume>
            <fpage>394</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9864186</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Construction of a cytomegalovirus-based amplicon: a vector with a unique transfer capacity</p>
            </title>
            <aug>
               <au>
                  <snm>Borst</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Messerle</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Hum Gene Ther</source>
            <pubdate>2003</pubdate>
            <volume>14</volume>
            <fpage>959</fpage>
            <lpage>70</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/104303403766682223</pubid>
                  <pubid idtype="pmpid" link="fulltext">12869214</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A complex between the MHC class I homologue encoded by human cytomegalovirus and beta 2 microglobulin</p>
            </title>
            <aug>
               <au>
                  <snm>Browne</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>GSB</fnm>
               </au>
               <au>
                  <snm>Minson</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1990</pubdate>
            <volume>347</volume>
            <fpage>770</fpage>
            <lpage>2</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/347770a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">2172831</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Sequential loss of CD34 and class II MHC antigens on purified cord blood hematopoietic progenitors cultured with IL-3: characterization of CD34-, HLA-DR+ cells</p>
            </title>
            <aug>
               <au>
                  <snm>Caux</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Favre</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Saeland</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Duvert</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Mannoni</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Durand</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Aubry</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>deVries</snm>
                  <fnm>JE</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1989</pubdate>
            <volume>74</volume>
            <fpage>1287</fpage>
            <lpage>94</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2475184</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Analysis of the protein-coding content of the sequence of the human cytomegalovirus strain AD169</p>
            </title>
            <aug>
               <au>
                  <snm>Chee</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Bankier</snm>
                  <fnm>ATSB</fnm>
               </au>
               <au>
                  <snm>Bohni</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Cerny</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Horsnell</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hutchison</snm>
                  <fnm>CA</fnm>
                  <suf>III</suf>
               </au>
               <au>
                  <snm>Kouzarides</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Martignetti</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Preddie</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Satchwell</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Tomlinson</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Weston</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Barrell</snm>
                  <fnm>BG</fnm>
               </au>
            </aug>
            <source>Current Topics in Microbiology and Immunology</source>
            <publisher>Berlin: Springer-Verlag</publisher>
            <editor>McDougall JK</editor>
            <pubdate>1990</pubdate>
            <volume>154</volume>
            <fpage>125</fpage>
            <lpage>169</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2161319</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>A 189-bp repeat region within the human cytomegalovirus replication origin contains a sequence dispensable but irreplaceable with other sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Sugano</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1999</pubdate>
            <volume>258</volume>
            <fpage>240</fpage>
            <lpage>248</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1999.9735</pubid>
                  <pubid idtype="pmpid" link="fulltext">10366561</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Strain-dependent differences in the human cytomegalovirus replication origin</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Watanabe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamaguchi</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Arch of Virology</source>
            <pubdate>1996</pubdate>
            <volume>141</volume>
            <fpage>13</fpage>
            <lpage>30</lpage>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Tandem repeat defective DNA from the L segment of the HSV genome</p>
            </title>
            <aug>
               <au>
                  <snm>Cuifo</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Hayward</snm>
                  <fnm>GS</fnm>
               </au>
            </aug>
            <source>Herpesvirus DNA Series</source>
            <publisher>The Hague: Martinus Nijhoff</publisher>
            <editor>Becker Y</editor>
            <pubdate>1981</pubdate>
            <fpage>107</fpage>
            <lpage>128</lpage>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Properties of peripheral blood and cord blood stem cells</p>
            </title>
            <aug>
               <au>
                  <snm>de Wynter</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Emmerson</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Testa</snm>
                  <fnm>NG</fnm>
               </au>
            </aug>
            <source>Baillierres Best Pract Res Clin Haematol</source>
            <pubdate>1999</pubdate>
            <volume>12</volume>
            <fpage>1</fpage>
            <lpage>17</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1053/beha.1999.0003</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Herpes simplex virus amplicon: cleavage of concatemeric DNA is linked to packaging and involves amplification of the terminally reiterated a sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Deiss</snm>
                  <fnm>LP</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1986</pubdate>
            <volume>57</volume>
            <fpage>933</fpage>
            <lpage>41</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">252824</pubid>
                  <pubid idtype="pmpid">3005637</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Efficient human immunodeficiency virus-based vector transduction of unstimulated human mobilized peripheral blood CD34+ cells in the SCID-hu Thy/Liv model of human T cell lymphopoiesis</p>
            </title>
            <aug>
               <au>
                  <snm>Douglas</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>WY</fnm>
               </au>
               <au>
                  <snm>Panis</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Veres</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Hum Gene Ther</source>
            <pubdate>2001</pubdate>
            <volume>12</volume>
            <fpage>401</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/10430340150504028</pubid>
                  <pubid idtype="pmpid" link="fulltext">11242532</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells</p>
            </title>
            <aug>
               <au>
                  <snm>Fraefel</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Lang</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Wild</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Geller</snm>
                  <fnm>AI</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1996</pubdate>
            <volume>70</volume>
            <fpage>7190</fpage>
            <lpage>97</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">190772</pubid>
                  <pubid idtype="pmpid" link="fulltext">8794366</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Anatomy of herpes simplex virus DNA. VI. Defective DNA originates from the S component</p>
            </title>
            <aug>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Locker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Batterson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Hayward</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Roizman</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1976</pubdate>
            <volume>20</volume>
            <fpage>527</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">355020</pubid>
                  <pubid idtype="pmpid">185428</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Human cytomegalovirus open reading frame US28 encodes a functional beta chemokine receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Gao</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>PM</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1994</pubdate>
            <volume>269</volume>
            <fpage>28539</fpage>
            <lpage>42</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7961796</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Helper virus-free herpes simplex virus-1 plasmid vectors for gene therapy of Parkinson's disease and other neurological disorders</p>
            </title>
            <aug>
               <au>
                  <snm>Geller</snm>
                  <fnm>AI</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Fraefel</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Exp Neurol</source>
            <pubdate>1997</pubdate>
            <volume>144</volume>
            <fpage>98</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/exnr.1996.6394</pubid>
                  <pubid idtype="pmpid" link="fulltext">9126158</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Retroviral vector-mediated gene transfer into umbilical cord blood CD34br, CD38-, CD33- cells</p>
            </title>
            <aug>
               <au>
                  <snm>Gentry</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Exp Hematol Stem Cell Res</source>
            <pubdate>1999</pubdate>
            <volume>27</volume>
            <issue>8</issue>
            <fpage>1244</fpage>
            <lpage>54</lpage>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Expansion and transduction of nonenriched human cord blood cells using HS-5 conditioned medium and FLT3-L</p>
            </title>
            <aug>
               <au>
                  <snm>Goerner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Roecklein</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Torok-Storb</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Heimfeld</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kiem</snm>
                  <fnm>HP</fnm>
               </au>
            </aug>
            <source>J Hematother Stem Cell Res</source>
            <pubdate>2000</pubdate>
            <volume>9</volume>
            <fpage>759</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/15258160050196803</pubid>
                  <pubid idtype="pmpid">11091500</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Cytomegalovirus remains latent in a common precursor of dendritic and myeloid cells</p>
            </title>
            <aug>
               <au>
                  <snm>Hahn</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Jores</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>3937</fpage>
            <lpage>42</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">19941</pubid>
                  <pubid idtype="pmpid" link="fulltext">9520471</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.7.3937</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Identification of the lytic origin of DNA replication in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chain termination</p>
            </title>
            <aug>
               <au>
                  <snm>Hamzeh</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Lietman</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Hayward</snm>
                  <fnm>GS</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1990</pubdate>
            <volume>64</volume>
            <fpage>6184</fpage>
            <lpage>6195</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">248793</pubid>
                  <pubid idtype="pmpid">2173786</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Amplicon-based herpes simplex virus vectors</p>
            </title>
            <aug>
               <au>
                  <snm>Ho</snm>
                  <fnm>DY</fnm>
               </au>
            </aug>
            <source>Methods Cell Biol</source>
            <pubdate>1994</pubdate>
            <volume>43</volume>
            <fpage>191</fpage>
            <lpage>210</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7823862</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>HSV-1-based vectors for gene therapy of neurological diseases and brain tumors: part II. Vector systems and applications</p>
            </title>
            <aug>
               <au>
                  <snm>Jacobs</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Breakfield</snm>
                  <fnm>XO</fnm>
               </au>
               <au>
                  <snm>Fraefel</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Neoplasia</source>
            <pubdate>1999</pubdate>
            <volume>1</volume>
            <fpage>402</fpage>
            <lpage>416</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.neo.7900056</pubid>
                  <pubid idtype="pmpid" link="fulltext">10933055</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Defined large-scale alterations of the human cytomegalovirus genome constructed by cotransfection of overlapping cosmids</p>
            </title>
            <aug>
               <au>
                  <snm>Kemble</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Duke</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Winter</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Spaete</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1996</pubdate>
            <volume>70</volume>
            <fpage>2044</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">190037</pubid>
                  <pubid idtype="pmpid" link="fulltext">8627734</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>A host cell protein binds to a highly conserved sequence element (pac-2) with the cytomegalovirus <it>a </it>sequence</p>
            </title>
            <aug>
               <au>
                  <snm>Kemble</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1989</pubdate>
            <volume>63</volume>
            <fpage>4715</fpage>
            <lpage>28</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">251108</pubid>
                  <pubid idtype="pmpid">2552148</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Human cytomegalovirus latent infection of granulocyte-macrophage progenitors</p>
            </title>
            <aug>
               <au>
                  <snm>Kondo</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kaneshima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1994</pubdate>
            <volume>91</volume>
            <fpage>11879</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">45339</pubid>
                  <pubid idtype="pmpid" link="fulltext">7991550</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Biology of herpes simplex virus (HSV) defective viruses and development of the amplicon system</p>
            </title>
            <aug>
               <au>
                  <snm>Kwong</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>"Viral Vectors"</source>
            <publisher>Academic Press, Inc</publisher>
            <pubdate>1995</pubdate>
            <fpage>25</fpage>
            <lpage>42</lpage>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Structure and origin of defective genomes contained in serially passaged herpes simplex type 1 (Justin)</p>
            </title>
            <aug>
               <au>
                  <snm>Locker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1979</pubdate>
            <volume>29</volume>
            <fpage>1065</fpage>
            <lpage>77</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">353267</pubid>
                  <pubid idtype="pmpid">221666</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Primate cytomegaloviruses encode and express an IL-10-like protein</p>
            </title>
            <aug>
               <au>
                  <snm>Lockridge</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Kravitz</snm>
                  <fnm>RH</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Sawai</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Blewett</snm>
                  <fnm>EL</fnm>
               </au>
               <au>
                  <snm>Barry</snm>
                  <fnm>PA</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2000</pubdate>
            <volume>268</volume>
            <fpage>272</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2000.0195</pubid>
                  <pubid idtype="pmpid" link="fulltext">10704336</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Stable transduction with lentiviral vectors and amplification of immature hematopoietic progenitors from cord blood of preterm human fetuses</p>
            </title>
            <aug>
               <au>
                  <snm>Luther-Wyrsch</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Costello</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Thali</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Buetti</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Nissen</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Surbek</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Holzgreve</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Gratwohl</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tichelli</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wodnar-Filipowicz</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Hum Gene Ther</source>
            <pubdate>2001</pubdate>
            <volume>12</volume>
            <fpage>377</fpage>
            <lpage>89</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/10430340150504000</pubid>
                  <pubid idtype="pmpid" link="fulltext">11242530</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Infection of hematopoietic progenitor cells by human cytomegalovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Maciejewski</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Bruening</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Donahue</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Young</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>St Jeor</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1992</pubdate>
            <volume>80</volume>
            <fpage>170</fpage>
            <lpage>78</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1377049</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>The role of HSV amplicon vectors in cancer gene therapy</p>
            </title>
            <aug>
               <au>
                  <snm>Mahmood</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tolba</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Federoff</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Rosenblatt</snm>
                  <fnm>JD</fnm>
               </au>
            </aug>
            <source>Gene Therapy and Molecular Biology</source>
            <pubdate>1999</pubdate>
            <volume>4</volume>
            <fpage>209</fpage>
            <lpage>219</lpage>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Molecular cloning: a laboratory manual</p>
            </title>
            <aug>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <publisher>Cold Spring Harbor Laboratory Press, Cold Spring Harbor</publisher>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Human cytomegalovirus origin of DNA replication (oriLyt) resides within a highly complex repetitive region</p>
            </title>
            <aug>
               <au>
                  <snm>Masse</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Karlin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schachtel</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>Proceedings of the National Academy of Science USA</source>
            <pubdate>1992</pubdate>
            <volume>89</volume>
            <fpage>5246</fpage>
            <lpage>5250</lpage>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Detection of endogenous human cytomegalovirus in CD34+ bone marrow progenitors</p>
            </title>
            <aug>
               <au>
                  <snm>Mendelson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Monard</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sissons</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Sinclair</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Gen Virol</source>
            <pubdate>1996</pubdate>
            <volume>77</volume>
            <fpage>3099</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9000102</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Human cytomegalovirus in a SCID-hu mouse: thymic epithelial cells are prominent targets of viral replication</p>
            </title>
            <aug>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Bonyhadi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Salimi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McCune</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Kaneshima</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1993</pubdate>
            <volume>90</volume>
            <fpage>104</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">45608</pubid>
                  <pubid idtype="pmpid" link="fulltext">7678330</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Structure and variability of the a sequence in the genome of human cytomegalovirus (Towne strain)</p>
            </title>
            <aug>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Spaete</snm>
                  <fnm>RR</fnm>
               </au>
            </aug>
            <source>J Gen Virol</source>
            <pubdate>1987</pubdate>
            <volume>68</volume>
            <fpage>2223</fpage>
            <lpage>30</lpage>
            <xrefbib>
               <pubid idtype="pmpid">3039048</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Site-specific inversion sequence of the herpes simplex virus genome: domain and structural features</p>
            </title>
            <aug>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Roizman</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1981</pubdate>
            <volume>78</volume>
            <fpage>7047</fpage>
            <lpage>51</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">349191</pubid>
                  <pubid idtype="pmpid">6273905</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Cytomegaloviruses and Their Replication</p>
            </title>
            <aug>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Courcelle</snm>
                  <fnm>CT</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <publisher>Lippincott &#8211; Williams &amp; Wilkins Publishers, Philadelphia</publisher>
            <pubdate>2001</pubdate>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Cyclic appearance of defective interfering particles of herpes simplex virus and the concomitant accumulation of early polypeptide VP175</p>
            </title>
            <aug>
               <au>
                  <snm>Murray</snm>
                  <fnm>BK</fnm>
               </au>
               <au>
                  <snm>Biswal</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Bookout</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Lanford</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Courtney</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Melnick</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>Intervirology</source>
            <pubdate>1975</pubdate>
            <volume>5</volume>
            <fpage>173</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubid idtype="pmpid">172470</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor</p>
            </title>
            <aug>
               <au>
                  <snm>Neote</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>DiGregorio</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Mak</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Horuk</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Schall</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1993</pubdate>
            <volume>72</volume>
            <fpage>415</fpage>
            <lpage>25</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(93)90118-A</pubid>
                  <pubid idtype="pmpid">7679328</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Eleven loci encoding trans-acting factors are required for transient complementation of human cytomegalovirus oriLyt-dependent DNA replication</p>
            </title>
            <aug>
               <au>
                  <snm>Pari</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Anders</snm>
                  <fnm>DG</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1993</pubdate>
            <volume>67</volume>
            <fpage>6979</fpage>
            <lpage>88</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">238157</pubid>
                  <pubid idtype="pmpid">8230421</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Cytomegalovirus encodes a potent alpha chemokine</p>
            </title>
            <aug>
               <au>
                  <snm>Penfold</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Dairaghi</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Duke</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Saederup</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Kemble</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Schall</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>9839</fpage>
            <lpage>44</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">22297</pubid>
                  <pubid idtype="pmpid" link="fulltext">10449781</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.17.9839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Defective virions of human cytomegalovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Ramirez</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Virmani</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Garon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Rosenthal</snm>
                  <fnm>LJ</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1979</pubdate>
            <volume>96</volume>
            <fpage>311</fpage>
            <lpage>14</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(79)90201-0</pubid>
                  <pubid idtype="pmpid">223307</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>The Family Herpesviridae: A Brief Introduction</p>
            </title>
            <aug>
               <au>
                  <snm>Roizman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Pellett</snm>
                  <fnm>PE</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <publisher> Lippincott &#8211; Williams &amp; Wilkins Publishers, Philadelphia</publisher>
            <pubdate>2001</pubdate>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Tamplicon-7, a novel T-lymphotrpic vector derived from human herpesvirus 7</p>
            </title>
            <aug>
               <au>
                  <snm>Romi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Singer</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Rapaport</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1999</pubdate>
            <volume>73</volume>
            <fpage>7001</fpage>
            <lpage>07</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">112786</pubid>
                  <pubid idtype="pmpid" link="fulltext">10400799</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Cytomegalovirus-encoded beta chemokine promotes monocyte-associated viremia in the host</p>
            </title>
            <aug>
               <au>
                  <snm>Saederup</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>YC</fnm>
               </au>
               <au>
                  <snm>Dairaghi</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Schall</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>10881</fpage>
            <lpage>86</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">17977</pubid>
                  <pubid idtype="pmpid" link="fulltext">10485920</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.19.10881</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>DNA sequencing with chain-terminating inhibitors</p>
            </title>
            <aug>
               <au>
                  <snm>Sanger</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Nicklen</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Coulson</snm>
                  <fnm>AR</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci U S A</source>
            <pubdate>1977</pubdate>
            <volume>74</volume>
            <fpage>5463</fpage>
            <lpage>67</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">431765</pubid>
                  <pubid idtype="pmpid">271968</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>An unusual defective genotype derived from herpes simplex virus strain ANG</p>
            </title>
            <aug>
               <au>
                  <snm>Schroder</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Stegmann</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Lauppe</snm>
                  <fnm>HF</fnm>
               </au>
               <au>
                  <snm>Kaerner</snm>
                  <fnm>HC</fnm>
               </au>
            </aug>
            <source>Intervirology</source>
            <pubdate>1975</pubdate>
            <volume>6</volume>
            <fpage>270</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubid idtype="pmpid">186436</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Human cytomegalovirus suppression of and latency in early hematopoietic progenitor cells</p>
            </title>
            <aug>
               <au>
                  <snm>Sindre</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tjoonnfjord</snm>
                  <fnm>GE</fnm>
               </au>
               <au>
                  <snm>Rollag</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ranneberg-Nilsen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Veiby</snm>
                  <fnm>OP</fnm>
               </au>
               <au>
                  <snm>Beck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Degre</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hestdal</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1996</pubdate>
            <volume>88</volume>
            <fpage>4526</fpage>
            <lpage>33</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8977244</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Quantitative analysis of latent human cytomegalovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Slobedman</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1999</pubdate>
            <volume>73</volume>
            <fpage>4806</fpage>
            <lpage>12</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">112523</pubid>
                  <pubid idtype="pmpid" link="fulltext">10233941</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Definition of a subset of human peripheral blood mononuclear cells that are permissive to human cytomegalovirus infection</p>
            </title>
            <aug>
               <au>
                  <snm>Soderberg</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Larsson</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bergstedt-Lindqvist</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Moller</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1993</pubdate>
            <volume>67</volume>
            <fpage>3166</fpage>
            <lpage>75</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">237655</pubid>
                  <pubid idtype="pmpid">7684461</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Reactivation of latent human cytomegalovirus by allogeneic stimulation of blood cells from healthy donors</p>
            </title>
            <aug>
               <au>
                  <snm>Soderberg-Naucler</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Fish</snm>
                  <fnm>KN</fnm>
               </au>
               <au>
                  <snm>Nelson</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1997</pubdate>
            <volume>91</volume>
            <fpage>119</fpage>
            <lpage>26</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(01)80014-3</pubid>
                  <pubid idtype="pmpid">9335340</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>The herpes simplex virus amplicon: A new eucaryotic defective-virus cloning-amplifying vector</p>
            </title>
            <aug>
               <au>
                  <snm>Spaete</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1982</pubdate>
            <volume>30</volume>
            <fpage>295</fpage>
            <lpage>304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0092-8674(82)90035-6</pubid>
                  <pubid idtype="pmpid">6290080</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>The <it>a </it>sequence of the cytomegalovirus genome functions as a cleavage/packaging signal for herpes simplex virus defective genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Spaete</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1985</pubdate>
            <volume>54</volume>
            <fpage>817</fpage>
            <lpage>824</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">254869</pubid>
                  <pubid idtype="pmpid">2987533</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>DNA of human cytomegalovirus: size heterogeneity and defectiveness resulting from serial undiluted passage</p>
            </title>
            <aug>
               <au>
                  <snm>Stinski</snm>
                  <fnm>MF</fnm>
               </au>
               <au>
                  <snm>Mocarski</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Thomsen</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1979</pubdate>
            <volume>31</volume>
            <fpage>231</fpage>
            <lpage>39</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">353439</pubid>
                  <pubid idtype="pmpid">228055</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Localization of an origin of DNA replication within the TRS/IRS repeated region of the herpes simplex virus type 1 genome</p>
            </title>
            <aug>
               <au>
                  <snm>Stow</snm>
                  <fnm>ND</fnm>
               </au>
            </aug>
            <source>Embo J</source>
            <pubdate>1982</pubdate>
            <volume>1</volume>
            <fpage>863</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6329712</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Characterization of the TRS/IRS origin of DNA replication of herpes simplex virus type 1</p>
            </title>
            <aug>
               <au>
                  <snm>Stow</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>McMonagle</snm>
                  <fnm>EC</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1983</pubdate>
            <volume>130</volume>
            <fpage>427</fpage>
            <lpage>38</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(83)90097-1</pubid>
                  <pubid idtype="pmpid">6316638</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Fragments from both termini of the herpes simplex virus type 1 genome contain signals required for the encapsidation of viral DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Stow</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>McMonagle</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Davison</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1983</pubdate>
            <volume>11</volume>
            <fpage>8205</fpage>
            <lpage>20</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">326576</pubid>
                  <pubid idtype="pmpid">6324078</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Improved titers for helper virus-free herpes simplex virus type 1 plasmid vectors by optimization of the packaging protocol and addition of noninfectious herpes simplex virus-related particles (previral DNA replication enveloped particles) to the packaging procedure</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Geller</snm>
                  <fnm>AI</fnm>
               </au>
            </aug>
            <source>Hum Gene Ther</source>
            <pubdate>1999</pubdate>
            <volume>10</volume>
            <fpage>2005</fpage>
            <lpage>11</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/10430349950017365</pubid>
                  <pubid idtype="pmpid" link="fulltext">10466634</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Structure of the heterogeneous L-S junction region of human cytomegalovirus strain AD169 DNA</p>
            </title>
            <aug>
               <au>
                  <snm>Tamashiro</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Filpula</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Friedmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Spector</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1984</pubdate>
            <volume>52</volume>
            <fpage>541</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">254556</pubid>
                  <pubid idtype="pmpid">6092675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Terminal structure and heterogeneity in human cytomegalovirus strain AD169</p>
            </title>
            <aug>
               <au>
                  <snm>Tamashiro</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Spector</snm>
                  <fnm>DH</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1986</pubdate>
            <volume>59</volume>
            <fpage>591</fpage>
            <lpage>604</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">253215</pubid>
                  <pubid idtype="pmpid">3016322</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Functional analysis of the human cytomegalovirus US28 gene by insertion mutagenesis with the green fluorescent protein gene</p>
            </title>
            <aug>
               <au>
                  <snm>Vieira</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Schall</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Corey</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Geballe</snm>
                  <fnm>AP</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <fpage>8158</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">110158</pubid>
                  <pubid idtype="pmpid" link="fulltext">9733857</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Replication of herpes simplex virus DNA: localization of replication recognition signals within defective virus genomes</p>
            </title>
            <aug>
               <au>
                  <snm>Vlazny</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Frenkel</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1981</pubdate>
            <volume>78</volume>
            <fpage>742</fpage>
            <lpage>46</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">319878</pubid>
                  <pubid idtype="pmpid">6262768</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Detection of cytomegalovirus DNA in CD34+ cells from blood and bone marrow</p>
            </title>
            <aug>
               <au>
                  <snm>von Laer</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Meyer-Koenig</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Serr</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Finke</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kanz</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fauser</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Neumann-Haefelin</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Brugger</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Hufert</snm>
                  <fnm>FT</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>1995</pubdate>
            <volume>86</volume>
            <fpage>4086</fpage>
            <lpage>90</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7492764</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>Structure of the joint region and the termini of the DNA of herpes simplex virus type 1</p>
            </title>
            <aug>
               <au>
                  <snm>Wagner</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Summers</snm>
                  <fnm>WC</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1978</pubdate>
            <volume>27</volume>
            <fpage>374</fpage>
            <lpage>87</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">354176</pubid>
                  <pubid idtype="pmpid">211266</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Immune modulation of human B lymphocytes by gene transfer with recombinant Epstein-Barr virus amplicons</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Seldin</snm>
                  <fnm>DC</fnm>
               </au>
               <au>
                  <snm>Annis</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Trocha</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>RP</fnm>
               </au>
            </aug>
            <source>J Virol Methods</source>
            <pubdate>1998</pubdate>
            <volume>72</volume>
            <fpage>81</fpage>
            <lpage>93</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-0934(98)00023-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">9672135</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>A hybrid herpesvirus infectious vector based on Epstein-Barr virus and herpes simplex virus type 1 for gene transfer into human cells in vitro and in vivo</p>
            </title>
            <aug>
               <au>
                  <snm>Wang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Vos</snm>
                  <fnm>J-M</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1996</pubdate>
            <volume>70</volume>
            <fpage>8422</fpage>
            <lpage>8430</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">190931</pubid>
                  <pubid idtype="pmpid" link="fulltext">8970963</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

