The E. coli expression plasmid WRG7079 (PowderJect Inc., Madison, WI, USA) contains the kanamycin resistance gene, a ColE1-based origin of replication and a eukaryotic expression unit harboring the cytomegalo virus (CMV) promoter and enhancer region, Intron A, the tissue plasminogen activator (tPA) secretion signal, a polylinker, and the polyadenylation signal from bovine growth hormone (BGHpA). The synthetic gp120 gene with human codons from the primary, CCR5-tropic, clade B HIV-1_BX08 has been cloned into WRG7079 5 and is named pEC120 (6.2 kb). A variant of pEC120 containing ISS CpG motifs was constructed. An 80 bp CpG cassette (ATCGACTCTCGAGCGTTCTATCGACTCTCGAGCGTTCTCACTCTCGAGCGTTCTCGCTAGACGTTAGCGTTCAACGTTGA) containing 12 CpGs (bold) including human and mouse ISS motifs 20212223, was introduced between the stop codon of the gp120 gene and the BGHpA. This plasmid was named pEC120CpG. The eukaryotic expression units from pEC120 and pEC120CpG were cloned into the L. lactis pJAG5 cloning vector 10. PJAG5 contains the hom-thrB auxotroph marker, the minimal theta type replicon, and a polylinker region for cloning (Fig. 1). The threonine auxotrophic L. lactis strain, MG1614ΔhomthrB, was used for cloning and plasmid production 12. Selection of primary transformants and growth under selective conditions was done in defined medium lacking threonine 10. The HIV-1_BX08 gp120 expression unit was obtained from pEC120 using PCR and primers homologous to the 5' end of the CMV promoter (5'-CGG

GGTACC

GGTACC

The E. coli based plasmids were produced and purified using Qiagen Midiprep according to the manufacturer (Qiagen, Hilden, DE). The L. lactis-based plasmids were purified similarly but with modifications as follows. A 100 ml (OD₆₀₀ = 3) culture was harvested and washed in 20 ml TE buffer containing 7% sucrose (STE). Cells were resuspended in 4 ml STE containing 20 mg/ml lysozyme (Sigma) and 0.1 mg/ml RNase H (Sigma) and incubated at 37°C for 60 min. Four ml NaOH-SDS buffer (#P2 from Qiagen) was added and incubated for 5 min at room temperature. Four ml of ice cold potassium acetate buffer (#P3 from Qiagen) was added and mixed before incubated 30 min on ice and centrifuged at 20,000 g at 4°C for 1 h. The clear supernatant was applied to midi cartridges and thereafter handled as suggested (Qiagen). The quality of the PBS dissolved DNA was analysed by agarose gel electrophoresis and evaluation of the A260/A280 ratio.

To examine eukaryotic expression the syn.gp120_BX08 gene, the human HEK293 kidney fibroblast cell line (ATCC, Rockville, MD) was transfected with pLL120, pLL120CpG, pEC120, and pEC120CpG, respectively, using Effectene transfection kit (Qiagen). Radioimmunoprecipitation (RIPA) of ³⁵S-met and ³⁵S-cys labelled protein using gp120 specific antibodies was done as described 5.

6–7 weeks-old BALB/c mice were purchased from Bomholdtgaard (Taconic, Ry, DK) and kept in groups of five per cage with food and water ad libitum and artificial light 12 h per day. The acclimatization period before immunization was 5 days. Mice were immunized intramuscularly (i.m.) in Tibialis anterior with 50 μl of 2 mg/ml plasmid in endotoxin-free PBS buffer using pLL120, pLL120CpG, pEC120, and pEC120CpG, respectively. The four vaccine constructs were tested on four groups of 10 mice each (n = 10). A group of 5 mice received PBS buffer alone and served as a negative control. Mice were vaccinated at week 0, 9 and 15. Blood samples were drawn one day prior to the first immunization as a pre-immune control serum (day 0), and thereafter every third week. The experiment was terminated at week 19.

Mouse anti HIV-1 gp120 antibodies were measured by indirect ELISA. Wells of polystyrene plates (Maxisorb, Nunc, Roskilde, DK) were coated for 2 days at room temperature with HIV-1 IIIB recombinant gp120 (Intracel) at 0.2 μg/100 μl of carbonate buffer, pH 9.6. Before use the plates were blocked for 1 h at room temperature with 150 μl/well of washing buffer (PBS, 0.5 M NaCl, 1% Triton-X-100) plus 2% BSA and 2% skim milk powder. After 3 × 1 min washings, mouse plasma was added at 100 μl/well diluted in blocking buffer and the ELISA plates were incubated for 90 min at room temperature using a microtiter plate shaker. The standard curve was made from a pool of plasma consisting of BX08 gp120 positive mice sera 5. Plates were again washed 5 × 1 min and incubated 1 h at room temperature with 100 μl/well of HRP-conjugated rabbit anti-mouse IgG (DAKO-Cytomation, Glostrup, DK) diluted 1:1000 in blocking buffer. Colour was developed with 100 μl/well of peroxidase enzyme substrate consisting of 4 mg of o-phenylenediamine in 11 ml water plus 4 μl hydrogen peroxide (30%, w/w). The reaction was terminated after 30 min by 150 μl/well of 1 M H₂SO₄. The optical density (OD) of wells was measured at 492 nm using a microplate photometer. Anti-HIV-gp120 IgG titers were expressed as the reciprocal of the plasma dilution resulting in an OD_{492 nm} value of 0.500.

IgG1 and IgG2a were analysed by capture gp120 sandwich ELISA 2425. Briefly, Maxisorb 96-well plates (NUNC) were pre-coated overnight with PBS containing 1 μg/ml sheep-anti-gp120 (Aalto, Dublin, IR), washed 5 times in PBS containing 0.05% Tween-20 and incubated for 2 h at room temperature with 100 μl 1% Triton X-100 treated cell-free culture supernatant from 5.25.EGFP.Luc.M7 cells (donated by Ned Landau, Salk Institute, CA, USA) which were infected chronically with HIV-1_BX08. A dilution series of plasma samples from each mouse was incubated for 2 h at room temperature. Wells were washed five times in PBS-Tween-20 and incubated with HRP-conjugated Rat anti-mouse IgG1 or -IgG2a antibodies (Pharmingen Brøndby, DK) both diluted 1:1000 in dilution buffer (0.5 M NaCl, 3 mM KCl, 15 mM KH₂PO₄, 6 mM Na₂HPO₄:2H₂O, 2% Triton-X 100, 1% w/v BSA, 0.1% w/v phenol-red) and incubated for 1 h at room temperature. Wells were washed five times as above and once using distilled water before colorimetric development using 100 μl o-phenylenediamine substrate solution (Kem-En-Tec, Taastrup, DK). The reaction was stopped with 150 μl 1 M H₂SO₄ and absorbance measured at 490 nm.

Mouse spleens were removed aseptically at week 19 and gently homogenized to single cell suspension, washed 3 times in cold RPMI1640 (Invitrogen, Taastrup, DK) supplemented with 10% fetal calf serum (FCS) (Invitrogen) and resuspended to a final concentration of 5 × 10⁷ cell/ml. Spleens from individual mice were homogenised and transferred to a round-bottom 96-well plate (2 × 10⁵ cells per well). Wells, containing a total volume of 200 μl RPMI1640 with 10% FCS, were incubated for 6 h at 37°C with 50 U/ml of IL-2 (Roche, Hvidovre, DK), monensin (3 μM) (Sigma, Brøndby, DK) with and without a 15-mer peptide derived from the V3-loop of HIV-1_BX08 containing a conserved murine H-2D^d restricted CTL epitope (IGPGRAFYTT). Wells were washed and cells re-suspended in 50 μl medium containing fluorescent antibodies for the relevant surface markers, CD4-FITC, CD8-PECy7, and CD44-APC (Pharmingen) and incubated for 20 min in the dark at 4°C. Then 100 μl monensin (3 μM) in PBS was added before centrifugation at 400 × g for 5 min. Cells were resuspended in 100 μl monensin (3 μM) in PBS and 100 μl 2% paraformaldehyde (Merck, Damstadt, DE) and incubated for 30 min in the dark at 4°C. Cells were pelleted and resuspended in 100 μl PBS solution containing 3 μM monensin and 1% BSA. Cells were pelleted and resuspended in 200 μl PBS containing 0.5 % Saponin (Sigma) and incubated in the dark for 10 min at room temperature. Cells were pelleted and incubated for 20 min at 4 °C with 50 μl 0.5 % saponin solution containing PE conjugated anti-IFN-γ antibodies (Pharmingen) to stain for intracellular IFN-γ. Cells were washed twice with 100 μl 0.5 % saponin/PBS solution before addition of a fixing solution containing 2% paraformaldehyde. Fixed cells were analysed on a BD LSR-II flowcytometer (Becton Dickenson) using the BD FACS Diva software.

For assay of cytotoxic T lymphocytes (CTL) the splenocytes were incubated 5 days with mitomycin-C treated (50 μg/ml for 1 h) and CTL epitope peptide loaded mouse P815 (H-2D^d) stimulator cells at a ratio of 10:1 in medium supplemented with 5 × 10^-5 M β-mercaptoethanol. For assay of cytolytic CTL response to HIV-1_BX08, P815 target cells were pulsed with 20 μg/ml of the HIV-1_BX08 V3 peptide SIHIGPGRAFYTTGD containing the H-2D^d restricted CTL epitopeCorbet, 2. After stimulation splenocytes were washed three times with RPMI1640 supplemented with 10% FCS and resuspended to a final concentration of 5 × 10⁶ cells/ml. Cell suspension (100 μl) was added in triplicate to U-bottom 96-well microtiter plates and a standard 4 h ⁵¹Cr-release assay performed as described 4.

Splenocytes were prepared from spleens of non-immunized 6–12 weeks old female BALB/c mice. Cells were cultured in 96-well U-bottom plates at 37°C and 5% CO₂ and maintained in RPMI1640 supplemented with 10% FCS, 1% penicillin/streptomycin, and 0.1% mercaptoethanol. Splenocytes (3 × 10⁵ cells/well) were treated with RPMI1640 medium, plasmid (3 ug/well) or plasmid DNA treated with DNase I (Biolab, Risskov, DK) using 1 U DNase per 1 ug DNA for 1 hr at 37°C followed by inactivation at 75°C for 10 min. The synthesis of IL-6 and IFN-γ in supernatants of cells cultured for 0, 1, 2, and 3 days was measured by sandwich ELISA kits (R&D Systems, Minneapolis, MN).

The characteristics of the L. lactis (pLL120 and pLL120CpG) and E. coli (pEC120 and pEC120CpG) based vectors are shown in Fig. 1. Sequence analysis showed that the L. lactis vector backbone had a lower GC content (37%) than the E. coli vector (48%) and contained two copies of a known immune stimulatory mouse CpG motifs (GACGTT), while the E. coli vector backbone only contained one CpG motif. Even though the synthetic gp120 gene is very GC rich (56%) because of the humanized codons, it did not contain classical ISS motifs, but did harbour three human CpG motifs (two copies of GTCGTT and one copy of CTCGAG). The added CpG minigene contained 12 CpG dinucleotides giving rise to six consensus ISS CpG motifs (5'-two purines-CpG-two pyrimidines-3') including two copies of the mouse ISS CpG motifs (GACGTT and AACGTT) 22. Thus, when inserted the CpG minigene increased the numbers of mouse ISS motifs by two. However, unidentified mouse ISS or immune inhibitory CpG motifs may be present in the plasmids.

To evaluate the influence of the plasmid backbone on the expression levels of the gp120 gene, human kidney cells were transiently transfected. The expression of the syn.gp120_BX08 gene using the L. lactis or E. coli-based vectors was examined by RIPA of ³⁵S-labelled supernatant proteins from transfected HEK293 cells and purified IgG from a pool of HIV sero-positive patients. ³⁵S-labelled supernatant from untransfected cells served as a negative control and was also precipitated but did not produce a protein with a molecular weight of 120 kDa (Fig. 2). Cells transfected with the any of the four vaccine plasmids produced a 120 kDa product (Fig. 2). The expression levels of gp120 were comparable for pLL120 and pEC120 as well as for pLL120CpG and pEC120CpG. For both types of vectors the amounts of gp120 expressed seemed somewhat lower when they harboured the CpG cassette. The L. lactis based vectors drive therefore antigen synthesis as efficiently as the E. coli based vectors. Furthermore, the produced gp120 was immunogenic as antibodies from HIV-1 sero positive patients recognize the in vitro produced HIV protein (Fig. 2).

We examined the humoral responses in the DNA vaccinated mice using ELISA (Fig. 3). The four different plasmids (Fig. 1) were each administered to four groups of 10 mice, respectively. Mice immunized i.m. with the pLL120 and pLL120CpG at weeks 0, 9, and 15 induced specific IgG antibodies to the gp120 protein with the same kinetics and maximum titers as the mice receiving the E. coli based plasmids. The first immunization induced high specific antibodies in all mice. The titers obtained were similar to those obtained in previous mouse DNA vaccination experiments using the syn.gp120_BX08 in WRG7079 5. The second immunization at week nine boosted the antibody titers about one hundred times in all groups. Further boosting at week 15 had less effect. The titers obtained at each time point were indistinguishable from those obtained with the corresponding vectors containing the putative ISS CpG cassette. The negative control group receiving buffer alone showed no anti-gp120 antibody titers above the background (data not shown). Thus, the kinetics and the magnitude of the anti-gp120 antibody induction was similar using the L. lactis-based pJAG5 and the E. coli-based plasmid backbones.

The antibody subclass profile of the induced response was analysed. Here gp120 specific IgG1 and IgG2a were determined by ELISA to be used as a surrogate marker for the Th1/Th2 balance (Fig. 4). Mice immunized with the L. lactis based plasmids induced an IgG1/IgG2a ratio indistinguishable from that induced by the E. coli based pEC120 and pEC120CpG. Furthermore, the IgG1/IgG2a ratios obtained from the data from similar vectors with and without the CpG cassette were statistically indistinguishable (two sample t-test, P > 0.05). All IgG1 and IgG2a ratios were above 1 and below 1.5, which is indicative of a mixed Th1:Th2 response with a slight Th2 predominance (Fig. 4).

We examined the cellular immune response in mice after genetic immunizations with syn.gp120_BX08 by cytolytic CTL assay and staining for intracellular induction of IFN-γ (IC-FACS) (Figs. 5 and 6). A strong cellular immune response was induced by the four vectors that were significantly higher than both the background (unloaded target cells) and the flat response obtained from unimmunized mice (data not shown). This confirms the in vivo expression and immunogenicity of gp120_BX08 expressed from both L. lactis and E. coli vectors. After five days of epitope stimulation a somewhat higher cytolytic CTL response was obtained with the E. coli-based plasmid as compared to the L. lactis-based plasmid (Fig. 5). Addition of the ISS CpG cassette increased this specific CTL response for both vectors albeit more pronounced for the E. coli based vector (Fig. 5).

The cellular response was also analysed by IC-FACS staining for direct epitope-peptide-induced IFN-γ production in CD8⁺ T-cells (Fig. 6). The analysis confirmed specific cellular immunity induced by the vaccine gene in the four vectors. This IFN-γ induction was, however, lower for the L. lactis based vectors than for the corresponding E. coli-based vectors.

To evaluate the immune stimulatory properties of the vaccine plasmids splenocytes were co-incubated with plasmid DNA and the induction of pro-inflammatory cytokines were analysed. Interestingly, the L. lactis-based vectors induced a higher synthesis of both IFN-γ and IL-6 than the corresponding E. coli vectors (Fig. 7). Furthermore, addition of the CpG minigene to the L. lactis vector caused a significantly higher induction of both IFN-γ and IL-6 compared to the pLL120 without the CpG minigene. To analyse if this stimulatory effect is caused by the plasmid DNA or by contaminants in the DNA preparation the DNA was enzymatically degraded. DNase treatment of the plasmid solutions abolished the pro-inflammatory effect (Fig. 7). Therefore, the immune stimulatory induction by the L. lactis vaccine vectors is directly linked to the plasmid DNA and not to contaminants that may be present in the DNA preparations.