1479-0556-7-7 1479-0556 Research <p>Enhancement of the expression of HCV core gene does not enhance core-specific immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen</p> Alekseeva Ekaterina kate@biomed.lu.lv Sominskaya Irina irina@biomed.lu.lv Skrastina Dace daceskr@biomed.lu.lv Egorova Irina egorovai69@mail.ru Starodubova Elizaveta estarodubova@gmail.com Kushners Eriks gaishaisrx@inbox.lv Mihailova Marija mary@biomed.lu.lv Petrakova Natalia nvpetrakova@hotmail.com Bruvere Ruta Bruvere@biomed.lu.lv Kozlovskaya Tatyana Tatyana@biomed.lu.lv Isaguliants Maria maria.isaguliants@smi.ki.se Pumpens Paul paul@biomed.lu.lv

Latvian Biomedical Research and Study Centre, Ratsupites 1, Riga, LV-1067, Latvia

Swedish Institute of Infectious Disease Control, SE-17182 Stockholm, Sweden

Pasteur Institute, 197101 St Petersburg, Russia

Microbiology and Tumorbiology Center, Karolinska Institutet, 17177 Stockholm, Sweden

D.I. Ivanovsky Institute of Virology, 123098 Moscow, Russia

 Genetic Vaccines and Therapy 1479-0556 2009 7 1 7 http://www.gvt-journal.com/content/7/1/7 19505299 10.1186/1479-0556-7-7 16 12 2008 08 6 2009 08 6 2009 2009 Alekseeva et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Hepatitis C core protein is an attractive target for HCV vaccine aimed to exterminate HCV infected cells. However, although highly immunogenic in natural infection, core appears to have low immunogenicity in experimental settings. We aimed to design an HCV vaccine prototype based on core, and devise immunization regimens that would lead to potent anti-core immune responses which circumvent the immunogenicity limitations earlier observed.

Methods

Plasmids encoding core with no translation initiation signal (pCMVcore); with Kozak sequence (pCMVcoreKozak); and with HCV IRES (pCMVcoreIRES) were designed and expressed in a variety of eukaryotic cells. Polyproteins corresponding to HCV 1b amino acids (aa) 1–98 and 1–173 were expressed in E. coli. C57BL/6 mice were immunized with four 25-μg doses of pCMVcoreKozak, or pCMV (I). BALB/c mice were immunized with 100 μg of either pCMVcore, or pCMVcoreKozak, or pCMVcoreIRES, or empty pCMV (II). Lastly, BALB/c mice were immunized with 20 μg of core aa 1–98 in prime and boost, or with 100 μg of pCMVcoreKozak in prime and 20 μg of core aa 1–98 in boost (III). Antibody response, [3H]-T-incorporation, and cytokine secretion by core/core peptide-stimulated splenocytes were assessed after each immunization.

Results

Plasmids differed in core-expression capacity: mouse fibroblasts transfected with pCMVcore, pCMVcoreIRES and pCMVcoreKozak expressed 0.22 ± 0.18, 0.83 ± 0.5, and 13 ± 5 ng core per cell, respectively. Single immunization with highly expressing pCMVcoreKozak induced specific IFN-γ and IL-2, and weak antibody response. Single immunization with plasmids directing low levels of core expression induced similar levels of cytokines, strong T-cell proliferation (pCMVcoreIRES), and antibodies in titer 103(pCMVcore). Boosting with pCMVcoreKozak induced low antibody response, core-specific T-cell proliferation and IFN-γ secretion that subsided after the 3rd plasmid injection. The latter also led to a decrease in specific IL-2 secretion. The best was the heterologous pCMVcoreKozak prime/protein boost regimen that generated mixed Th1/Th2-cellular response with core-specific antibodies in titer ≥ 3 × 103.

Conclusion

Thus, administration of highly expressed HCV core gene, as one large dose or repeated injections of smaller doses, may suppress core-specific immune response. Instead, the latter is induced by a heterologous DNA prime/protein boost regimen that circumvents the negative effects of intracellular core expression.

Background

Globally, an estimated 170 million people are chronically infected with hepatitis C virus (HCV), and 3 to 4 million persons are newly infected each year 12. The human immune system has difficulties in clearing the virus in either the acute, or chronic phase of the infection with up to 40% of patients progressing to cirrhosis and liver failure 3456. Extensive studies have unraveled important reliable correlates of viral clearance 7891011. This, together with the growing need to diminish the magnitude of HCV associated liver disease served as a basis for intensive HCV vaccine research. A series of HCV vaccine candidates have moved into clinical trials 11. One such is the peptide vaccine IC41 consisting of a panel of MHC class I and class II restricted epitopes adjuvanted by poly-L-arginine administered to healthy volunteers 12 and to chronic HCV patients including non-responders to the standard therapy 1314. Another therapeutic vaccine employed peptides chosen individually for their ability to induce the strongest in vitro cellular response 15. In a further vaccine trial, chronic hepatitis C patients received the recombinant HCV envelope protein E1 16. The first clinical trial of an HCV DNA vaccine consisting of a codon-optimized NS3/4A gene administered to chronic hepatitis C patients is currently ongoing (CHRONVAC-C®; http://www.clinicaltrials.gov/ct2/results?term=NCT00563173; http://www.bion.no/moter/Vaccine/Matti_S%E4llberg.pdf).

So far, none of the peptide or protein vaccines were able to induce a significant improvement in the health conditions of chronic HCV patients, or a significant decrease of HCV RNA load, specifically if compared to the conventional IFN-based therapy 131516. The vaccine trials have, however, demonstrated that when achieved, HCV RNA decline in the vaccine recipients correlates with induction of strong IFN-gamma T-cell response 13. Such a response can best be recruited by DNA vaccines, either alone or with the aid of heterologous boosts 1117. Indeed, vaccination of chimpanzees showed the ability to elicit effective immunity against heterologous HCV strains using T-cell oriented HCV genetic vaccines that stimulated only the cellular arm of the immune system 1718.

An attractive target for HCV vaccine is the nucleocapsid (core) protein 192021. It is highly conserved among various HCV genotypes with amino acid homology exceeding 95% 2122. Core binds and packages the viral genomic RNA, regulates its translation 23242526 and drives the production of infectious viruses 272829. Core contributes to HCV persistence also indirectly by interfering with host cell transcription, apoptosis, lipid metabolism, and the development of immune response 30313233. Extermination of core expressing cells and inhibition of the activity of extracellular core (non-enveloped particles containing HCV RNA 34) could be highly beneficial.

Ideally, HCV core could be eliminated by a specific vaccine-induced immune response. It is a strong immunogen with anti-core immune response evolving very early in infection 3536. Early and broad peripheral and intrahepatic CD8+ T-cell and antibody response to core/core epitopes is registered in chimpanzees controlling HCV infection HCV, but not in chimpanzees that become chronically infected 373839. In mice, potent experimentally induced anti-core immune response conferred partial protection against challenge with core expressing recombinant vaccinia virus 40. However, despite high immunogenicity in the natural infection, core does not perform well as an immunogen, specifically if introduced as naked DNA 2414243. Attempts to enhance core immunogenicity by targeting HCV core protein to specific cellular compartments 44, co-immunization with cytokine expressing plasmids 241, adjuvants as CpG 45, or truncated core gene versions 46 had limited or no success.

Prime-boost strategies have been used to increase immune responses to a number of DNA vaccines. Immunization regimens comprised of a DNA prime and a viral vector boost for instance for vaccinia virus 4748, adenovirus 49, fowlpox 5051, and retrovirus 52. Priming with DNA and boosting with protein is another promising approach. This regimen has been studied for HIV 5354, hepatitis C virus 5556, anthrax 57, Mycobacteria 5859, Streptococcus pneumoniae 60 and BVDV 61. DNA vaccines and recombinant protein vaccines utilize different mechanisms to elicit antigen-specific responses. Due to the production of antigen in transfected cells of the host, a DNA vaccine induces robust T-cell responses, which are critical for the development of T-cell-dependent antibody responses 62. DNA immunization is also highly effective in priming antigen-specific memory B cells. In contrast, a recombinant protein vaccine is generally more effective at eliciting antibody responses than cell-mediated immune responses and may directly stimulate antigen-specific memory B cells to differentiate into antibody-secreting cells, resulting in production of high titer antigen-specific antibodies 63. Therefore, a DNA prime plus protein boost is a complementary approach that overcomes each of their respective shortcomings. Certain improvement of the immune response was reached after co-delivery of HCV core DNA and recombinant core 24064. In this study, we have shown that in DNA immunization, poor core-specific immune response can be a consequence of high levels of intracellular core expression, and that such a response can be improved by using low-expressing core genes, or single core gene primes in combination with recombinant core protein boosts.

Methods

Plasmids for expression of HCV core

Region encoding aa 1–191 of HCV core was reverse-transcribed and amplified from HCV 1b isolate 274933RU (GeneBank accession #AF176573) 65 using oligonucleotide primers: sense GATCCAAGCTTATGAGCACGAATCC and antisense GATCCCTCGAGTCAAGCGGAAGCTGG containing recognition sites of HindIII and XhoI restriction endonucleases. The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 (Invitrogen, USA) cleaved with HindIII/XhoI resulting in pCMVcore. Region encoding aa 1–191 of HCV core was also reverse-transcribed and amplified from HCV isolate 274933RU using another set of primers that carried Kozak consensus sequence sense AGCTGCTAGCGCCGCCACCATGAGCACGAATCCT and antisense GATCGTTAACTAAGCGGAAGCTGGATGG primers containing recognition sites of restriction endonucleases NheI and XhoI, respectively. The amplified DNA was cleaved with NheI/KspAI and inserted into the plasmid pCMVE2/p7-2 66 cleaved with NheI/XhoI, resulting in pCMVcoreKozak. The region corresponding to HCV 5'UTR, and coding sequences for aa 1–809 was reverse-transcribed and amplified from HCV 1b isolate AD78P1 (GeneBank accession #AJ132997) 67, kindly provided by Prof. M. Roggendorf (Essen, Germany) using sense-GACCCAAGCTTCGTAGACCGTGCACCAT and antisense CATGCTCGAGTTAGGCGTATGCTCG primers. The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 cleaved with HindIII/XhoI resulting in pCMVcoreIRES. HCV 274933RU core differed from HCV AD78P1 core in positions 70 (H versus R), 75 (T versus A), and 147 (V versus T), respectively.

Growth of pcDNA3, pCMVcore, pCMVcoreKozak, and pCMVcoreIRES was accomplished in the E. coli strain DH5alpha. Plasmid DNA was extracted and purified by Endo Free plasmid Maxi kit (Qiagen GmbH, Germany). The purified plasmids were dissolved in the phosphate buffered saline (PBS) and used for in vitro expression assays and for DNA immunization.

Cell transfection, lysis and Western-blotting

BHK-21, COS-7, and NIH3T3 cells were seeded into plates (3 × 105 cells/well) and transfected by plasmid DNA (2 μg) using Lipofectamine (GIBCO-BRL, Scotland) or ExGen 500 (Fermentas, Lithuania) as described by the manufacturers. HCV core expression was analyzed 24, 48 and 72 h post transfection. Cells were lysed for 10 min at 0°C in the buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM PMSF and 1% NP-40. Lysates were cleared by 10 min centrifugation at 6000 g, resolved by 12% SDS-PAAG, and transferred to PVDF membranes (Amersham Pharmacia Biotech, Ireland). HCV core expression was detected by immunostaining with polyclonal rabbit anti-core antibodies 68, and secondary horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulins (Amersham Pharmacia Biotech, Ireland) followed by ECL™ detection (ECL Plus, Amersham Pharmacia Biotech, Ireland).

Quantification of core expression in mouse cells

NIH3T3 cells were transfected with either pcDNA3, pCMVcore, pCMVcoreKozak, pCMVcoreIRES, or pEGFP-N1 (Clontech, CA, USA). The percent of transfection was evaluated by counting the number of GFP expressing cells per 500 transfected NIH3T3 cells using a fluorescence Leica DM 6000 microscope (Leica Camera AG, Germany). Cells were harvested 48 h post-transfection, counted, and 104 cells were lysed in 2× SDS Sample buffer. Lysates and samples containing 1 to 50 ng of recombinant core aa 1–173 (corresponding to p21) were run simultaneously on 12% SDS-PAAG and transferred onto PVDF membrane for calibration. Blots were blocked overnight in PBS-T with 5% non-fat dry milk, stained with polyclonal anti-core antibodies #35-6 (1:5000) followed by the secondary anti-rabbit HRP-conjugated antibodies (DAKOPatts AB, Denmark). Signals were detected using the ECL™ system (Amersham Pharmacia Biotech, Ireland). X-ray films were scanned, and processed using Image J software http://rsb.info.nih.gov/ij. The data are presented as the Mean Grey Values (MGV). The core content was quantified by plotting the MGV of each sample onto a calibration curve prepared using recombinant core aa 1–173. After core detection, blots were striped according to the ECL protocol and re-stained with monoclonal anti-tubulin antibodies (Sigma, USA) and secondary anti-mouse HRP-conjugated antibodies (DAKOPatts AB, Denmark). Core content per transfected cell was evaluated after accounting for the percent of transfection and normalization to the tubulin content per well.

Immunofluorescence staining

BHK-21 cells were seeded on the chamber slides (Nunc International, Denmark) and transfected as above. 24 h post transfection, the slides were dried, fixed with acetic acid and ethanol (1:3) for 15 min and rinsed thoroughly in distilled water. Fixed cells were re-hydrated in PBS, and incubated for 24 h at 4°C with anti-HCV core rabbit polyclonal antibodies (1:50) in the blocking buffer (PBS with 2.5 mM EDTA and 1% BSA). Secondary antibodies were goat anti-rabbit immunoglobulins labeled with TRITC (1:200; DAKO, Denmark). Slides were then mounted with PermaFluor aqueous mounting medium (Immunon, Pa., USA) and read using a fluorescence microscope.

Recombinant HCV-core proteins and core-derived peptides

Peptides covering core amino acids 1–18, 1–20, 23–43, 34–42, 133–142 and a control peptide TTAVPWNAS from gp41 of HIV-1 were purchased from Thermo Electron GmbH (Germany). Core proteins representing aa 1–152 of HCV 274933RU and aa 1–98, and 1–173 of AD78P1 were expressed in E. coli and purified by chromatography as was described earlier 6970. Purified proteins were dissolved in PBS.

Mice and immunization

The following immunizations were performed:

Scheme I

Groups of 12 female 8-week old C57BL/6 mice (Stolbovaya, Moscow Region, Russia) were immunized with a total of 100 μg of pCMVcoreKozak, or empty vector, split into four i.m. injections done with 3–4 week intervals. Control mice were mock-immunized with PBS.

Scheme II

Female 6–8 week old BALB/c mice (Animal Breeding Centre of the Institute of Microbiology and Virology, Riga) had injected into their Tibialis anterior (TA), 50 μl of 0.01 mM cardiotoxin (Latoxan, France) in sterile 0.9% NaCl five days prior to immunization. Groups of 6 to 7 mice were immunized with a single 100 μg dose of either pCMVcoreIRES, or pCMVcore, or pCMVcoreKozak, or empty vector, all dissolved in 100 μl PBS, applied intramuscularly (i.m.) into the cardiotoxin-treated TA. Control mice were left untreated.

Scheme III

Groups of 5 to 6 female 6–8 week old BALB/c mice pretreated with cardiotoxin, were injected i.m. with 100 μg of pCMVcoreKozak and boosted three weeks later with 20 μg of core aa 1–98 in PBS, or primed and boosted subcutaneously with 20 μg of core aa 1–98 in PBS. Control animals were left untreated.

ELISA

Mice were bled from retro-orbital sinus prior to, and 2 to 3 weeks after each immunization, or 5 weeks post a single gene immunization (in Scheme II). Peptides corresponding to core aa 1–20, 23–43 or 133–142 were coated onto 96-well MaxiSorp plates (Nunc, Denmark), and recombinant core aa 1–98, 1–152, or 1–173, on the 96-well PolySorp plates (Nunc, Denmark). Coating was done overnight at 4°C in 50 mM carbonate buffer, pH 9.6 at antigen concentration of 10 μg/ml. After blocking with PBS containing 1% BSA for 1 h at 37°C, serial dilutions of mouse sera were applied on the plates and incubated for an additional hour at 37°C. Incubation was followed by three washings with PBS containing 0.05% Tween-20. Afterwards, plates were incubated with the horseradish peroxidase-conjugated anti-mouse antibody (Sigma, USA) for 1 h at 37°C, washed, and substrate OPD (Sigma, USA) added for color development. Plates were read on an automatic reader (Multiscan, Sweden) at 492 nm. ELISA performed on plates coated with core aa 1–98, 1–152, or 1–173 showed similar results (data not shown). Immune serum was considered positive for anti-core antibodies whenever a specific OD value exceeded, by at least two-fold, the signals generated by: pre-immune serum reacting with core-derived antigen, and by immune serum reacting with BSA-coated plate, the assays performed simultaneously.

T-cell proliferation assay

For T-cell proliferation tests, mice were sacrificed and spleens were obtained two weeks after each immunization in Scheme I; and three and five weeks after the last immunization in Schemes II and III. Murine splenocytes were harvested using red blood cell lysing buffer (Sigma, USA), single cell-suspensions were prepared in RPMI 1640 supplemented with 2 mM L-Glutamine and 10% fetal calf serum (Gibco BRL, Scotland) at 6 × 106 cells/ml. Cell were cultured in U-bottomed microculture plates at 37°C in a humidified 5% CO2 chamber (Gibco, Germany). Cell stimulation was performed with peptides representing core aa 1–20, 23–43, 34–42 and recombinant core aa 1–98, 1–152, and aa 1–173 at dilutions to 3.1, 6.25, 12.5, 25.0, 50.0, and 100 μg/ml, all in duplicate. Concanavalin A (ConA) was used as a positive control at 2 μg/ml. Cells were grown for 72 h, after which [3H]-thymidine (1 μCi per well; Amersham Pharmacia Biotech, Ireland) was added. After an additional 18 h, cells were harvested onto cellulose filters and the radioactivity was measured on a beta counter (Beckman, USA). The results were presented as stimulation indexes (SI), which were calculated as a ratio of mean cpm obtained in the presence and absence of a stimulator (protein or peptide). Empty-vector immunized and control mice showed SI values of 0.8 ± 0.4. SI values ≥ 1.9 were considered as indicators of specific T-cell stimulation.

Quantification of cytokine secretion

For detection of cytokines, cell culture fluids from T-cell proliferation tests were collected, for IL-2 – 24 h, and for IL-4 and IFN-γ – 48 h post the on-start of T-cell stimulation. Detection of cytokines in the cell supernatants was performed using commercial ELISA kits (Pharmingen, BD Biosciences, CA, USA) according to the manufacturers' instructions.

Results

Cloning and expression

Plasmids were constructed encoding core of HCV 1b isolate 274933RU without translation initiation signals (pCMVcore); and with Kozak translation initiation signal (pCMVcoreKozak). Core with viral translation initiation signal IRES taken in the natural context was derived from HCV 1b isolate AD78P1 67. Viral cores had a minimal sequence difference in positions 70, 75, and 147, all three cases representing homologous substitutions.

Expression from these plasmids was tested both in vitro and in cell cultures. Plasmids pCMVcore and pCMVcoreKozak were used as the templates for the T7-driven mRNA transcription; mRNA was translated in vitro in the rabbit reticulocyte lysate system. Both mRNAs generated a translation product of approximately 23 kDa corresponding to the molecular mass of unprocessed HCV core (p23; data not shown). Next, core-expressing vectors were used to transfect a series of mammalian cell lines. Western blotting of BHK-21 and COS-7cells transfected with pCMVcore, pCMVcoreKozak and pCMVcoreIRES using core-specific antibodies demonstrated an accumulation of proteins with the expected molecular mass of 21 kDa that corresponds to core aa 1–171 cleaved from the full-length core by cellular proteases 7172 (Fig. 1). Minimal amounts of p23 were also detected, specifically after transfections of BHK-21 with pCMVcore and pCMVcoreIRES (Fig. 1). The overall level of HCV core synthesis in BHK-21 cells was somewhat higher than in COS-7 cells (Fig. 1). In both cell lines, the highest level of core expression was achieved with pCMVcoreKozak (Fig. 1, 2). All cells expressing core and immunostained with core-specific antibodies demonstrated cytoplasmic granular staining characteristic of the processed p21 form of HCV core 727374 (Fig. 2).

<p>Figure 1</p>

Expression of HCV core proteins

Expression of HCV core proteins. Expression of HCV core protein directed by pCMVcore (A), pCMVcoreKozak (B), pCMVcoreIRES (C) in COS-7 cells 72 h post-transfection (Field 1); in BHK-21 cells 48 h (Field 2) and 72 h post transfection (Field 3). Transfection with the recommended amount (lane 1), and two-fold excess of transfection reagent (lane 2).

 <p>Figure 2</p>

Immunocytochemical detection of HCV core proteins

Immunocytochemical detection of HCV core proteins. Immunocytochemical detection of HCV core expression after transfection of BHK-21 cellswith pCMVcore (A1–C1), pCMVcoreKozak (A2–C2, C4), pCMVcoreIRES (A3–C3); nontransfected BHK-21 cells (A4). Immunostaining for HCV core protein using rabbit polyclonal anti-HCVcore antibody 35-7 as primary and TRITC-conjugated anti-rabbit immunoglobulin (IgG) as secondary antibody (panel A); nuclear staining by DAPI (panel B); overlay of A and B (panel C); negative control (nontransfected BHK-21 cells) after staining (A4). Fluorescent images A1–4, B1–3, C1–3 and A4 were taken with Leica DM 6000 B microscope and a Leica DFC 480 camera, and confocal image of cells transfected with pCMVcoreKozak and showing cytoplasmic, granular distribution (C4) with a Leica TCS SP2 SE.

The expression capacity of the vectors was quantified in murine fibroblasts to reproduce DNA immunization that was to be done in mice. Core expression was assessed on Western blots of SDS-PAAG resolving lysates of NIH3T3 transfected with core expressing and control plasmids (Fig. 3A and 3B). Images of Western blots were processed using the ImageJ software and individual bands were represented in arbitrary units (Mean Grey Values, MGV). Their correspondence to core quantity was established using calibration curves built with the use of recombinant core aa 1–173 (see Additional file 1) after normalization to the percent of transfection and protein content of the samples. Plasmid pCMVcore with no translation initiation signals provided the lowest level of core expression (Fig. 3B). IRES promoted a two-fold increase, and the Kozak sequence, a 35-fold increase of core expression with > 15 ng of protein produced per expressing cell (Fig. 3B).

<p>Additional file 1</p>

Establishment of calibration curves for quantification of core expression in vitro. Recombinant core aa 1–173 in serial dilutions in the range of 10 to 25 ng (A), 10 to 100 ng (B), or 12.5 to 100 ng (C) was loaded on 15% SDS-PAAG and resolved by gel electrophoresis together with the study samples. Proteins were transferred to PVDF membrane and subjected to Western blotting with core-specific rabbit antibodies, and secondary anti-rabbit HRP-conjugated antibodies (DAKOPatts). Signals were registered using X-ray films and ECL detection system, images were saved, scanned, and signal of individual band corresponding to core was quantified by Image J http://rsb.info.nih.gov, and calibration curves were built (D).

Click here for file

 <p>Figure 3</p>

Expression of proteins in mouse fibroblasts NIH 3T3 48 h post-transfection

Expression of proteins in mouse fibroblasts NIH 3T3 48 h post-transfection. A calibration curve was prepared using recombinant core protein aa 1–173 loaded in amounts of 25, 20, 15, and 10 ng per well (lanes 5, 6, 7 and 8, respectively). Western blotting was done using rabbit anti-core antibodies 82 (A). ECL photos of blots were scanned, and images were quantified with ImageJ software http://rsb.info.nih.gov/ij. The results of quantification of HCV core expression in four independent experiments (B).

Immunization of mice with HCV core DNA

All plasmids were purified by standard protocols in accordance with a GLP practice for preparation of DNA vaccines, and used in a series of mouse immunization experiments.

HCV core DNA in priming and boosts

Plasmid directing the highest level of core expression was selected and a pilot experiment defining the strategy of DNA immunization was performed. C57BL/6 mice were immunized four times with 25 μg of pCMVcoreKozak, and core-specific antibody and cellular responses were evaluated. No specific response was registered after the 1st injection (data not shown). The immune response generated after the following three boosts is illustrated by Fig. 4. Three injections of 25 μg led to no increase of core-specific IgG response over the initial levels achieved after the first two plasmid injections (Fig. 4A). Three plasmid injections generated a better T-cell proliferative response to core and core-derived peptides than two. However, the response could not be boosted further (Fig. 4B). IFN-γ and IL-2 response to core was also boostable. However again, no boosting was seen after the initial two pCMVcoreKozak injections (Fig. 4C). Furthermore, the repeated injections led to a significant decrease of IL-2 secretion in response to splenocyte stimulation by recombinant core and peptides representing core N-terminus (p < 0.05; Fig. 4B, and data not shown). Core-specific IL-4 secretion was not detected.

<p>Figure 4</p>

Core-specific immune response in C57Bl/6 mice receiving 2 (2 × 25 μg), 3 (3 × 25 μg), and 4 (4 × 25 μg) injections of pCMVcoreKozak

Core-specific immune response in C57Bl/6 mice receiving 2 (2 × 25 μg), 3 (3 × 25 μg), and 4 (4 × 25 μg) injections of pCMVcoreKozak. Maximal titers of IgG specific to recombinant core and a peptide representing core aa 1–20 (A); T-cell proliferation measured as the stimulation index (SI) in response to HCV core (1–173) and a peptide pool covering aa 23–43 of HCV core (B); cytokine secretion (pg/ml) in response to recombinant HCV core (C). Data are average values for mice assayed at a given time point.

Thus, the development of core-specific immune responses occurred within six weeks after the on-start of immunization; repeated boosts with HCV core gene did not lead to a significant enhancement of core-specific immunity.

HCV core DNA as a single injection

In the next series of experiments, we selected BALB/c mice as a strain that is expected to support a better Th2-type response with stronger antibody production 75. Plasmid pCMVcore Kozak was given as a single 100 μg injection with the effect of repeated intramuscular DNA boosts substituted by pre-treatment of the injection sites by cardiotoxin 76. T-cell proliferative response, antibody production and cytokine secretion were monitored two and five weeks after immunization.

Significant responses in the form of core-specific IFN-γ and IL-2 secretion exceeding the background levels in empty-vector-immunized mice were detected five weeks after a single administration of HCV core gene (Fig.5). Immunization generated no core-specific T-cell response and a low titer of core-specific IgG. Antibody response against HCV core has already been shown to develop slowly 46, mirroring the development of anti-core antibody response in HCV infected individuals 77. Here as well, a slow increase in the level of anti-core antibodies was observed 35 days after a single gene injection as compared to levels detected at day 21 (data not shown). There was no difference between BALB/c and C57BL/6 mice with respect to core-specific IFN-γ secretion (Fig. 4C versus Fig. 5C), or core-specific IgG production (p > 0.05 Mann Whitney U-test; Fig. 4A versus Fig. 5A and Additional file 1).

<p>Figure 5</p>

Core-specific immune response in BALB/c mice immunized with one 100 μg dose of pCMVcoreKozak (n = 7), pCMVcoreIRES (n = 6), pCMVcore (n = 6), and empty vector (n = 7)

Core-specific immune response in BALB/c mice immunized with one 100 μg dose of pCMVcoreKozak (n = 7), pCMVcoreIRES (n = 6), pCMVcore (n = 6), and empty vector (n = 7). The highest titers of IgG specific to core reached throughout immunization (A); T-cell proliferation measured as the stimulation index (SI) in response to recombinant HCV cores aa 1–98 and aa 1–173 and peptide representing HCV core aa 133–142 (B); the levels of core-specific IFN-γ, IL-2, and IL-4 secretion in the cell culture fluids collected after splenocyte stimulation with HCV core aa 1–98 (C). Cytokine secretion in BALB/c mice is represented by the amounts detected in the pooled cell culture fluids from the T-cell proliferation test; therefore, no standard deviations are presented.

High core gene expression affects core-specific immune response

The magnitude of anti-core response suggested that the increase of HCV core gene dose either by one-time large dose injection, or by repeated injections of smaller doses, did not significantly enhance core-specific immunity. To delineate if that could be influenced by core expression level, BALB/c mice were immunized with a single dose of low-expressing core genes with no translation initiation signals (pCMVcore), or with IRES (pCMVcoreIRES). The results were compared to immunization with core gene regulated by the Kozak sequence (pCMVcoreIRES) (Fig. 5). The T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5). The highest anti-core IgG response was raised in mice immunized with pCMVcore that directed the lowest level of HCV core expression (Fig. 3; Fig. 5A). It was significantly higher than the antibody response induced by pCMVcoreKozak (p < 0.05); the immune response in pCMVcoreIRES-immunized mice was intermediate (Fig. 5A). The T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5B; p < 0.05). While IL-2 secretion was somewhat higher in mice immunized with highly expressing pCMVcoreKozak, both DNA immunogens provided a similar level of core-specific IFN-γ secretion (Fig. 5C).

Heterologous DNA prime-protein boost regimen

We aimed to see if core-specific immune response could be enhanced without increasing core gene doses, but instead by using the heterologous prime-boost immunization regimens. HCV core protein aa 1–98 and pCMVcoreKozak were used to immunize BALB/c mice either separately, or in the DNA prime-protein boost regimen. A high titer of core-specific antibodies was achieved only after the heterologous boost (Fig. 6A). The heterologous regimen effectively induced a proliferative response, both in SI values (p levels 0.034, Mann Whitney U-test) and in the number of positive T-cell proliferation tests (p level 0.014; Fig. 6B); and potent core-specific IFN-γ and IL-2 secretion (Fig. 6C). Core-specific IL-4 secretion was, in all cases, very low.

<p>Figure 6</p>

Core-specific immune response in BALB/c mice immunized with the recombinant N-terminal domain of HCV core aa 1–98 alone (n = 5); with pCMVcoreKozak (n = 7); and primed with pCMVcoreKozak and boosted with HCV core aa 1–98 (n = 6)

Core-specific immune response in BALB/c mice immunized with the recombinant N-terminal domain of HCV core aa 1–98 alone (n = 5); with pCMVcoreKozak (n = 7); and primed with pCMVcoreKozak and boosted with HCV core aa 1–98 (n = 6). The kinetics of IgG response to core aa 1–98 (A);-T-cell proliferation measured as the stimulation index (SI) in response to HCV core aa 1–98, recombinant core aa 1–173, and a peptide covering HCV core aa 133–142 (B); levels of core-specific IFN-γ and IL-2 secretion (pg/ml) in the pooled cell culture after splenocyte stimulation with HCV core aa 1–98 or aa 1–173 (C).

Heterologous regimen induced significant anti-core antibody production (Fig. 6A). Sera of mice primed with pCMVcoreKozak and boosted with core aa 1–98 were analysed for the presence of anti-core antibodies of IgG, IgG1, IgG2a, IgG2b and IgM subclasses, and the results were compared to seroreactvivity in mice immunized with single injection of core or core expressing plasmids (Fig. 7). Mice primed with pCMVcoreKozak and boosted with core protein had significantly higher levels of anti-core IgG than mice immunized with pCMVcoreKozak (p = 0.0006, Mann-Whitney U-test) or pCMVcore (p = 0.002) (immunization with pCMVcore gave higher level of IgG than immunization with pCMVcoreKozak, p < 0.05). Group with heterologous prime/boost regimen had also an increased levels of anti-core IgG1, although the difference with the control group did not reach the level of significance (p < 0.1). Antibodies of IgG2a or IgG2b subclasses were not found. Low specific anti-core IgM were observed only in mice immunized with recombinant core aa 1–98 (p < 0.1; Fig. 7). It was higher than in mice primed with core DNA and boosted with core protein (p level 0.05). At the same time, core-immunized mice had no anti-core IgG1 or IgG2 (Fig. 7). Thus, the heterologous core DNA prime/core protein boost regimen preferentially induced anti-core IgG, while protein immunization triggered mostly low-level anti-core IgM.

<p>Figure 7</p>

Spectrum of core-specific immune response

Spectrum of core-specific immune response. The kinetics of IgG, IgM, IgG1, IgG2a and IgG2b response to core aa 1–98 after immunization with different immunogens.

Discussion

The immune response in DNA immunization depends on the amount of antigen produced from the immunogen in vivo as predetermined by the gene dose and by the gene capacity to direct an efficient antigen expression 7879. Normally, the response increases with the increase of the dose and efficacy of gene expression (for examples, see 80818283). However, the DNA immunogen used here encodes not just a structural component of the virus, but also a pathogenic factor. HCV core protein interacts with a broad range of cellular proteins and influences numerous host cell functions 313239718485. Of importance for HCV vaccine design was to find to what extent the immune response to HCV core in DNA immunization is influenced (positively, or negatively) by the level of core expression as determined by gene dose (i), and gene expression efficacy (ii).

The first issue was addressed in a series of immunizations in which the same dose of HCV core was given as a single or split into multiple injections. We and others have earlier observed that repeated HCV core gene boosts do not lead to an enhancement of core-specific immune response 424668. On the contrary, both core-specific IFN-γ and IL-2 production 68 and anti-core antibody response 24664 appear to be down-regulated. Here as well, the overall comparison between immunizations carried out by single and multiple core gene injections in different mouse strains demonstrated that the outcomes of immunization with one 100 μg versus two to four 25 μg core gene doses were quite similar (Fig. 4; see also the summary in Additional file 2). Furthermore, antibody response was not boosted; T-cell proliferative response and core-specific IFN-γ secretion could not be boosted beyond the levels reached after the initial two injections, and core-specific IL-2 secretion even appeared to be suppressed. Thus, core-specific immune response can be achieved after single DNA immunization, while repeated core gene administration may actually suppress core-specific immunity.

<p>Additional file 2</p>

Summary on core-specific immune responses in BALB/c and C57BL/6 mice. Summarized data of immunization experiments performed in BALB/c and C57BL6 mice. The empty vector immunized group and the control group are composed of a mixture of BALB/c (n = 7) and C57BL6 (n = 12) mice. All the other groups had been described in Figures 4 to 6.

Click here for file

The issue of translation efficacy was assessed in single-dose immunizations with plasmids directing different levels of HCV core expression. There are different ways to increase the level of gene expression efficacy such as the use of strong promoters, optimal species-specific codons, and manipulations with RNA folding 787879. An important factor is the efficacy of translation initiation. In the CAP-dependent translation of mammalian genes it is determined by sequences flanking the AUG initiator codon. High levels of translation are achieved with the Kozak sequence, a guanine at position +4 and an adenine at -3 from AUG 8687. The alternative mechanisms of initiation site selection on eukaryotic cellular and viral mRNAs, also of HCV, include the translation initiation from IRESs (internal ribosome entry sites/segments) 88. Located in the 5'-UTR region of viral genome, HCV IRES is optimized to hijack the ribosomes and translation factors from the host for the translation of HCV polyprotein 89. Core is tightly involved in the IRES-mediated regulation of HCV translation with several regulatory signals localized in both core protein and core coding sequence 249091. Thus, the 5'-end of HCV genome incorporating 5'-UTR and core coding sequence were harmonized during evolution to provide for the levels of core expression essential for the virus.

Both CAP and IRES translation initiation options were employed in the design of core DNA immunogens. Eukaryotic expression vectors were constructed encoding core of HCV 1b without translation initiation signal (pCMVcore), core preceded by the 5'-UTR of HCV 1b isolate AD (pCMVcoreIRES), and core preceded by the consensus Kozak sequence (pCMVcoreKozak). The latter directed the expression of 35-fold more core than the gene devoid of the translation initiation signals, and 16-fold more core than the gene regulated by IRES. However, despite a considerable difference in the core expression capacity, Kozak- and IRES-regulated DNA immunogens induced similar levels of core-specific IFN-γ secretion (Fig. 5C). More so, while IL-2 secretion was somewhat higher in mice immunized with highly expressing pCMVcoreKozak, a T-cell proliferative response to core- and core-derived peptides was stronger in mice immunized with pCMVcoreIRES (Fig. 5B). Thus, high core expression levels did not promote a better core specific cellular response.

DNA-based immunization can induce potent antibody response including virus neutralizing antibodies 9293949596. However, no significant antibody response has ever been induced in core gene immunization unless it was followed by the protein boost 264. Anti-core antibody titers obtained here after immunization with both CAP- and IRES-regulated core genes were also low. Interestingly, however, significantly higher titers of anti-core antibodies were obtained in mice that received the least expressed core gene devoid of any translation regulation signals (pCMV core; Figs. 5A, 7). Thus, the use of highly expressing HCV core DNA did not promote an effective core-specific antibody response.

Altogether, this points to possible adverse effects of the high-level as well as of the prolonged HCV core gene expression. We have additional data in support of this concept from immunization of C57BL/6 mice with a synthetic truncated HCV core gene devoid of HCV core nucleotide-sequence dependent regulatory signals. The latter expressed HCV 1b core at five to six-fold lower levels than the viral full-length core gene 97, but nevertheless, was capable of inducing potent core-specific cellular and antibody response http://www.meetingsmanagement.com/dna_2004/index.htm98.

DNA immunization with antigens co-expressed in natural virus infection can result in inhibition of both protein expression and specific immune response 99. More so, pathological effects were reported of the repeated immunization with certain microbial genes, for example the hsp60 gene of Mycobacterium that causes necrotizing bronchointerstitial pneumonia and bronchiolitis in healthy mouse recipients, and multifocal regions of cellular necrosis in lungs when applied therapeutically 100101. HCV core is the factor of HCV pathogenicity. It activates cellular and viral promoters 102, induces ER- and mitochondrial stress 103104, regulates apoptosis 105106, tumorigenesis 107108, and induces abnormal lipid metabolism 109. In experimental systems, core expression leads to the development of diverse pathological effects including CD4+ T-cell depletion, liver steatosis, insulin resistance, and hepatocellular carcinoma 33110. One of the notable although controversial features is the capacity of HCV core to suppresses host immunity 32398485. These features of HCV core may explain why here a better immune response was achieved after single immunization with vectors providing for comparatively low HCV core expression.

Altogether, this points to the necessity to devise alternative immunization regimens that would help to circumvent possible adverse effects of HCV core.

Many approaches can be pursued, with DNA vaccination combined with heterologous protein or recombinant viral boosts considered as the most promising 11. The principle of this strategy is to prime T-cells to be antigen-specific and then, upon repeated exposure to a specific antigen, induce a rapid T-cell expansion. In heterologous boosts, the encoded antigen is delivered in a different form/different vehicle 111. DNA plasmids are perfectly fit for priming since they are internalized by antigen presenting cells and can induce antigen presentation via MHC class I or class II. Such heterologous regimens can be effective when infection occurs with both viral particles and virus-infected cells, and neither cellular, nor antibody response is sufficient for sterilizing protection or viral clearance, if acting alone. This approach may help to circumvent the negative effects of intracellular core expression. Indeed, here, the heterologous DNA-prime/protein boost strategy was shown to be advantageous to both immunizations with core DNA and with the recombinant core protein (Figs. 6, 7). Protein alone performed even worse than single DNA injections (Figs. 6, 7). Only the heterologous DNA-prime-protein boost regimen induced a significant core-specific antibody production and potent T-cell response of mainly Th1-profile. This may be beneficial since most correlates of spontaneous HCV clearance are Th1-oriented 32398485.

Conclusion

This data suggests that the administration of highly expressed HCV core gene, as well as repeated core gene injections may hamper core-specific immune response. The boosting effect of repeated core gene injections is transient as it disappears with subsequent injections. One possible way to enhance core-specific response is to deliver limited intracellular amounts of core, either by giving lower plasmid doses, or by giving vectors with low expression efficacy. An additional option is the use of heterologous DNA prime/protein boost regimen that leads to potent immune response of a mixed Th1/Th2-type. We are currently testing if transient HCV core gene expression and acquisition of anti-HCV core immunity affect the immune status and functionality of the immune system in gene recipients.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

IS and EK constructed plasmids and screened their immunogenicity; EA did experiments on expression and wrote a draft of the manuscript; ES and EI carried out quantifications of core expression; DS and NP did immunological experiments; RB conducted the immunocytochemistry; MI was involved with the immunological experiments, statistical evaluations and worked with the manuscript; TK and PP give useful scientific advice and revised the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank Prof. Eva Stankevica and her group for the oligonucleotide synthesis and automatic sequencing and Ms. Natalija Gabrusheva and Ms. Irena Timofeeva for technical assistance. This work was supported by grants from the Latvian Council of Science 05.1626, ERAF VPD1/ERAF/CFLA/05/APK/2.5.1./000021/010, EU #05-1000004-7748, the European Social Fund (ESF), the New Visby program of the Swedish Institute, CompuVac grant #LSHB-CT-2004-005246 and the Russian Foundation for Basic Research #08-04-01107-a.

 <p>Hepatitis C virus infection</p> Lauer GM Walker BD N Engl J Med 2001 345 41 52 10.1056/NEJM200107053450107 11439948 <p>Expression and immune response to hepatitis C virus core DNA-based vaccine constructs</p> Tokushige K Wakita T Pachuk C Moradpour D Weiner DB Zurawski VR Jr Wands JR Hepatology 1996 24 14 20 10.1002/hep.510240104 8707253 <p>Syringe exchanges: a public health response to problem drug use</p> Cox GM Lawless MC Cassin SP Geoghegan TW Ir Med J 2000 93 143 146 11072923 <p>Intrahepatic cytotoxic T lymphocytes specific for hepatitis C virus in persons with chronic hepatitis</p> Koziel MJ Dudley D Wong JT Dienstag J Houghton M Ralston R Walker BD J Immunol 1992 149 3339 3344 1385523 <p>Natural history and disease manifestations of hepatitis C infection</p> Theodore D Fried MW Curr Top Microbiol Immunol 2000 242 43 54 10592655 <p>Liver-derived CTL in hepatitis C virus infection: breadth and specificity of responses in a cohort of persons with chronic infection</p> Wong DK Dudley DD Afdhal NH Dienstag J Rice CM Wang L Houghton M Walker BD Koziel MJ J Immunol 1998 160 1479 1488 9570570 <p>Mutational escape from CD8+ T cell immunity: HCV evolution, from chimpanzees to man</p> Bowen DG Walker CM J Exp Med 2005 201 1709 1714 2213256 15939787 10.1084/jem.20050808 <p>The role of hepatitis C virus specific CD4+ T lymphocytes in acute and chronic hepatitis C</p> Diepolder HM Zachoval R Hoffmann RM Jung MC Gerlach T Pape GR J Mol Med 1996 74 583 588 10.1007/s001090050062 8912179 <p>Neutralizing antibody response during acute and chronic hepatitis C virus infection</p> Logvinoff C Major ME Oldach D Heyward S Talal A Balfe P Feinstone SM Alter H Rice CM McKeating JA Proc Natl Acad Sci USA 2004 101 10149 10154 454180 15220475 10.1073/pnas.0403519101 <p>Quantitative analysis of anti-hepatitis C virus antibody-secreting B cells in patients with chronic hepatitis C</p> Umemura T Wang RY Schechterly C Shih JW Kiyosawa K Alter HJ Hepatology 2006 43 91 99 10.1002/hep.20917 16323211 <p>Vaccines to prevent chronic hepatitis C virus infection: current experimental and preclinical developments</p> Wintermeyer P Wands JR J Gastroenterol 2007 42 424 432 10.1007/s00535-007-2057-5 17671756 <p>Immunogenicity and safety of a novel therapeutic hepatitis C virus (HCV) peptide vaccine: a randomized, placebo controlled trial for dose optimization in 128 healthy subjects</p> Firbas C Jilma B Tauber E Buerger V Jelovcan S Lingnau K Buschle M Frisch J Klade CS Vaccine 2006 24 4343 4353 10.1016/j.vaccine.2006.03.009 16581161 <p>Therapeutic vaccination of chronic hepatitis C nonresponder patients with the peptide vaccine IC41</p> Klade CS Wedemeyer H Berg T Hinrichsen H Cholewinska G Zeuzem S Blum H Buschle M Jelovcan S Buerger V Tauber E Frisch J Manns MP Gastroenterology 2008 134 1385 1395 10.1053/j.gastro.2008.02.058 18471515 <p>Functional and phenotypic characterization of peptide-vaccine-induced HCV-specific CD8+ T cells in healthy individuals and chronic hepatitis C patients</p> Schlaphoff V Klade CS Jilma B Jelovcan SB Cornberg M Tauber E Manns MP Wedemeyer H Vaccine 2007 25 6793 6806 10.1016/j.vaccine.2007.06.026 17686555 <p>Phase I clinical study of a personalized peptide vaccination for patients infected with hepatitis C virus (HCV) 1b who failed to respond to interferon-based therapy</p> Yutani S Yamada A Yoshida K Takao Y Tamura M Komatsu N Ide T Tanaka M Sata M Itoh K Vaccine 2007 25 7429 7435 10.1016/j.vaccine.2007.08.005 17845828 <p>A pilot study of therapeutic vaccination with envelope protein E1 in 35 patients with chronic hepatitis C</p> Nevens F Roskams T Van Vlierberghe H Horsmans Y Sprengers D Elewaut A Desmet V Leroux-Roels G Quinaux E Depla E Dincq S Stichele Vander C Maertens G Hulstaert F Hepatology 2003 38 1289 1296 10.1053/jhep.2003.50474 14578869 <p>Cell culture-produced hepatitis C virus impairs plasmacytoid dendritic cell function</p> Shiina M Rehermann B Hepatology 2008 47 385 395 10.1002/hep.21996 18064579 <p>A T-cell HCV vaccine eliciting effective immunity against heterologous virus challenge in chimpanzees</p> Folgori A Capone S Ruggeri L Meola A Sporeno E Ercole BB Pezzanera M Tafi R Arcuri M Fattori E Lahm A Luzzago A Vitelli A Colloca S Cortese R Nicosia A Nat Med 2006 12 190 197 10.1038/nm1353 16462801 <p>Characterization of the hepatitis C virus-encoded serine proteinase: determination of proteinase-dependent polyprotein cleavage sites</p> Grakoui A McCourt DW Wychowski C Feinstone SM Rice CM J Virol 1993 67 2832 2843 237608 8386278 <p>Proteolytic processing and membrane association of putative nonstructural proteins of hepatitis C virus</p> Hijikata M Mizushima H Tanji Y Komoda Y Hirowatari Y Akagi T Kato N Kimura K Shimotohno K Proc Natl Acad Sci USA 1993 90 10773 10777 47860 7504283 10.1073/pnas.90.22.10773 <p>Hepatitis C virus: structure, protein products and processing of the polyprotein precursor</p> Houghton M Selby M Weiner A Choo QL Curr Stud Hematol Blood Transfus 1994 1 11 7956324 <p>Hepatitis C virus genotypes and quasispecies</p> Davis GL Am J Med 1999 107 21S 26S 10.1016/S0002-9343(99)00376-9 10653451 <p>Specific in vitro association between the hepatitis C viral genome and core protein</p> Fan Z Yang QR Twu JS Sherker AH J Med Virol 1999 59 131 134 10.1002/(SICI)1096-9071(199910)59:2<131::AID-JMV1>3.0.CO;2-C 10459145 <p>Interaction of hepatitis C virus core protein with viral sense RNA and suppression of its translation</p> Shimoike T Mimori S Tani H Matsuura Y Miyamura T J Virol 1999 73 9718 9725 113018 10559281 <p>p26 protein and 33-nm particle associated with nucleocapsid of hepatitis C virus recovered from the circulation of infected hosts</p> Takahashi K Kishimoto S Yoshizawa H Okamoto H Yoshikawa A Mishiro S Virology 1992 191 431 434 10.1016/0042-6822(92)90204-3 1329328 <p>An RNA pseudoknot is an essential structural element of the internal ribosome entry site located within the hepatitis C virus 5' noncoding region</p> Wang C Le SY Ali N Siddiqui A RNA 1995 1 526 537 1482419 7489514 <p>Hepatitis C virus-like particle budding: role of the core protein and importance of its Asp111</p> Blanchard E Hourioux C Brand D Ait-Goughoulte M Moreau A Trassard S Sizaret PY Dubois F Roingeard P J Virol 2003 77 10131 10138 224611 12941925 10.1128/JVI.77.18.10131-10138.2003 <p>Core protein domains involved in hepatitis C virus-like particle assembly and budding at the endoplasmic reticulum membrane</p> Hourioux C Ait-Goughoulte M Patient R Fouquenet D Arcanger-Doudet F Brand D Martin A Roingeard P Cell Microbiol 2007 9 1014 1027 2216084 17257269 10.1111/j.1462-5822.2006.00848.x <p>Hepatitis C virus core protein, lipid droplets and steatosis</p> Roingeard P Hourioux C J Viral Hepat 2008 15 157 164 18086178 <p>Hepatitis C virus core protein is necessary for the maintenance of immortalized human hepatocytes</p> Basu A Meyer K Ray RB Ray R Virology 2002 298 53 62 10.1006/viro.2002.1460 12093173 <p>Hepatitis C virus biology</p> Giannini C Brechot C Cell Death Differ 2003 10 Suppl 1 S27 S38 10.1038/sj.cdd.4401121 12655344 <p>Hepatitis C virus clearance: the enigma of failure despite an impeccable survival strategy</p> Isaguliants MG Curr Pharm Biotechnol 2003 4 169 183 10.2174/1389201033489856 12769761 <p>Hepatitis C virus core protein: its coordinate roles with PA28gamma in metabolic abnormality and carcinogenicity in the liver</p> Mori Y Moriishi K Matsuura Y Int J Biochem Cell Biol 2008 40 1437 1442 10.1016/j.biocel.2008.01.027 18321762 <p>Nonenveloped nucleocapsids of hepatitis C virus in the serum of infected patients</p> Maillard P Krawczynski K Nitkiewicz J Bronnert C Sidorkiewicz M Gounon P Dubuisson J Faure G Crainic R Budkowska A J Virol 2001 75 8240 8250 115068 11483769 10.1128/JVI.75.17.8240-8250.2001 <p>Comparison of cytotoxic T-lymphocyte responses to hepatitis C virus core protein in uninfected and infected individuals</p> Jackson M Smith B Bevitt DJ Steward M Toms GL Bassendine MF Diamond AG J Med Virol 1999 58 239 246 10.1002/(SICI)1096-9071(199907)58:3<239::AID-JMV9>3.0.CO;2-V 10447419 <p>Immune response to epitopes of hepatitis C virus (HCV) structural proteins in HCV-infected humans and chimpanzees</p> Wang YF Brotman B Andrus L Prince AM J Infect Dis 1996 173 808 821 8603958 <p>Immunization with hepatitis C virus-like particles results in control of hepatitis C virus infection in chimpanzees</p> Elmowalid GA Qiao M Jeong SH Borg BB Baumert TF Sapp RK Hu Z Murthy K Liang TJ Proc Natl Acad Sci USA 2007 104 8427 8432 1895966 17485666 10.1073/pnas.0702162104 <p>Characterization of the immune response against hepatitis C infection in recovered, and chronically infected chimpanzees</p> Shata MT Anthony DD Carlson NL Andrus L Brotman B Tricoche N McCormack P Prince A J Viral Hepat 2002 9 400 410 10.1046/j.1365-2893.2002.00373.x 12431201 <p>Viral and immunological determinants of hepatitis C virus clearance, persistence, and disease</p> Thimme R Bukh J Spangenberg HC Wieland S Pemberton J Steiger C Govindarajan S Purcell RH Chisari FV Proc Natl Acad Sci USA 2002 99 15661 15668 137773 12441397 10.1073/pnas.202608299 <p>Hepatitis C virus (HCV) core protein enhances the immunogenicity of a co-delivered DNA vaccine encoding HCV structural antigens in mice</p> Alvarez-Lajonchere L Gonzalez M Alvarez-Obregon JC Guerra I Vina A costa-Rivero N Musacchio A Morales J Dueñas-Carrera S Biotechnol Appl Biochem 2006 44 9 17 10.1042/BA20050202 16367740 <p>Enhancement of cellular and humoral immune responses to hepatitis C virus core protein using DNA-based vaccines augmented with cytokine-expressing plasmids</p> Geissler M Gesien A Tokushige K Wands JR J Immunol 1997 158 1231 1237 9013964 <p>Immune responses to plasmid DNA encoding the hepatitis C virus core protein</p> Lagging LM Meyer K Hoft D Houghton M Belshe RB Ray R J Virol 1995 69 5859 5863 189461 7637033 <p>An epitope in hepatitis C virus core region recognized by cytotoxic T cells in mice and humans</p> Shirai M Okada H Nishioka M Akatsuka T Wychowski C Houghten R Pendleton CD Feinstone SM Berzofsky JA J Virol 1994 68 3334 3342 236824 7512163 <p>Targeting of hepatitis C virus core protein for MHC I or MHC II presentation does not enhance induction of immune responses to DNA vaccination</p> Vidalin O Tanaka E Spengler U Trepo C Inchauspe G DNA Cell Biol 1999 18 611 621 10.1089/104454999315024 10463057 <p>CpG immuno-stimulatory motifs enhance humoral immune responses against hepatitis C virus core protein after DNA-based immunization</p> Encke J zu Putlitz J Stremmel W Wands JR Arch Virol 2003 148 435 448 10.1007/s00705-002-0935-y 12607097 <p>A truncated variant of the hepatitis C virus core induces a slow but potent immune response in mice following DNA immunization</p> Duenas-Carrera S Alvarez-Lajonchere L Alvarez-Obregon JC Herrera A Lorenzo LJ Pichardo D Morales J Vaccine 2000 19 992 997 10.1016/S0264-410X(00)00209-7 11115726 <p>A DNA prime-modified vaccinia virus ankara boost vaccine encoding thrombospondin-related adhesion protein but not circumsporozoite protein partially protects healthy malaria-naive adults against Plasmodium falciparum sporozoite challenge</p> Dunachie SJ Walther M Epstein JE Keating S Berthoud T Andrews L Andersen RF Bejon P Goonetilleke N Poulton I Webster DP Butcher G Watkins K Sinden RE Levine GL Richie TL Schneider J Kaslow D Gilbert SC Carucci DJ Hill AV Infect Immun 2006 74 5933 5942 1594937 16988273 10.1128/IAI.00590-06 <p>Enhanced T-cell immunogenicity of plasmid DNA vaccines boosted by recombinant modified vaccinia virus Ankara in humans</p> McConkey SJ Reece WH Moorthy VS Webster D Dunachie S Butcher G Vuola JM Blanchard TJ Gothard P Watkins K Hannan CM Everaere S Brown K Kester KE Cummings J Williams J Heppner DG Pathan A Flanagan K Arulanantham N Roberts MT Roy M Smith GL Schneider J Peto T Sinden RE Gilbert SC Hill AV Nat Med 2003 9 729 735 10.1038/nm881 12766765 <p>Enhancing Th2 immune responses against amyloid protein by a DNA prime-adenovirus boost regimen for Alzheimer's disease</p> Kim HD Jin JJ Maxwell JA Fukuchi K Immunol Lett 2007 112 30 38 2001313 17686533 10.1016/j.imlet.2007.06.006 <p>Heterologous prime/boost immunization of rhesus monkeys by using diverse poxvirus vectors</p> Santra S Sun Y Parvani JG Philippon V Wyand MS Manson K Gomez-Yafal A Mazzara G Panicali D Markham PD Montefiori DC Letvin NL J Virol 2007 81 8563 8570 1951337 17553898 10.1128/JVI.00744-07 <p>Prime-boost vaccination with a fowlpox vector and an inactivated avian influenza vaccine is highly immunogenic in Pekin ducks challenged with Asian H5N1 HPAI</p> Steensels M Bublot M Van Borm S De Vriese J Lambrecht B Richard-Mazet A Chanavat-Bizzini S Duboeuf M Le Gros FX van den Berg T Vaccine 2009 27 646 654 10.1016/j.vaccine.2008.11.044 19056442 <p>Recombinant retrovirus-like particle forming DNA vaccines in prime-boost immunization and their use for hepatitis C virus vaccine development</p> Desjardins D Huret C Dalba C Kreppel F Kochanek S Cosset FL Tangy F Klatzmann D Bellier B J Gene Med 2009 11 4 313 25 10.1002/jgm.1307 19248137 <p>DNA-VLP prime-boost intra-nasal immunization induces cellular and humoral anti-HIV-1 systemic and mucosal immunity with cross-clade neutralizing activity</p> Buonaguro L Devito C Tornesello ML Schroder U Wahren B Hinkula J Buonaguro FM Vaccine 2007 25 5968 5977 10.1016/j.vaccine.2007.05.052 17629365 <p>The safety and tolerability of an HIV-1 DNA prime-protein boost vaccine (DP6-001) in healthy adult volunteers</p> Kennedy JS Co M Green S Longtine K Longtine J O'Neill MA Adams JP Rothman AL Yu Q Johnson-Leva R Pal R Wang S Lu S Markham P Vaccine 2008 26 4420 4424 10.1016/j.vaccine.2008.05.090 18588934 <p>DNA vaccination against hepatitis C</p> Duenas-Carrera S Curr Opin Mol Ther 2004 6 146 150 15195926 <p>Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models</p> Li YP Kang HN Babiuk LA Liu Q World J Gastroenterol 2006 12 7126 7135 17131474 <p>DNA vaccines against anthrax</p> Galloway DR Baillie L Expert Opin Biol Ther 2004 4 1661 1667 10.1517/14712598.4.10.1661 15461577 <p>Advances in tuberculosis vaccine strategies</p> Skeiky YA Sadoff JC Nat Rev Microbiol 2006 4 469 476 10.1038/nrmicro1419 16710326 <p>Improved Protective Efficacy of a Species-Specific DNA Vaccine Encoding Mycolyl-Transferase Ag85A from Mycobacterium ulcerans by Homologous Protein Boosting</p> Tanghe A Dangy JP Pluschke G Huygen K PLoS Negl Trop Dis 2008 2 e199 2265439 18350112 10.1371/journal.pntd.0000199 <p>Enhanced protective immunity against pneumococcal infection with PspA DNA and protein</p> Moore QC Bosarge JR Quin LR McDaniel LS Vaccine 2006 24 5755 5761 10.1016/j.vaccine.2006.04.046 16759765 <p>DNA prime protein boost strategies protect cattle from bovine viral diarrhea virus type 2 challenge</p> Liang R Hurk van den JV Landi A Lawman Z Deregt D Townsend H Babiuk LA van Drunen Littel-van den Hurk S J Gen Virol 2008 89 453 466 10.1099/vir.0.83251-0 18198376 <p>Immunization with plasmid DNA encoding a truncated, secreted form of the bovine viral diarrhea virus E2 protein elicits strong humoral and cellular immune responses</p> Liang R Hurk van den JV Zheng C Yu H Pontarollo RA Babiuk LA van Drunen Littel-van den Hurk S Vaccine 2005 23 5252 5262 10.1016/j.vaccine.2005.06.025 16154245 <p>Immunogenicity of DNA vaccines in humans: it takes two to tango</p> Lu S Hum Vaccin 2008 4 449 452 18443427 <p>Characterization of the humoral and cellular immune responses against hepatitis C virus core induced by DNA-based immunization</p> Hu GJ Wang RY Han DS Alter HJ Shih JW Vaccine 1999 17 3160 3170 10.1016/S0264-410X(99)00130-9 10462252 <p>[Genome analysis of hepatitis C virus strain 274933RU isolated in Russian Federation]</p> Mokhonov VV Novikov DV Samokhvalov EI Shatalov AG Selivanov NA Prilipov AG L'vov DK Vopr Virusol 2002 47 9 12 11852787 <p>Signal sequences modulate the immunogenic performance of human hepatitis C virus E2 gene</p> Sominskaya I Alekseeva E Skrastina D Mokhonov V Starodubova E Jansons J Levi M Prilipov A Kozlovska T Smirnov V Pumpens P Isaguliants MG Mol Immunol 2006 43 1941 1952 10.1016/j.molimm.2005.11.018 16442623 <p>Cloning and characterization of a complete open reading frame of the hepatitis C virus genome in only two cDNA fragments</p> Rispeter K Lu M Lechner S Zibert A Roggendorf M J Gen Virol 1997 78 Pt 11 2751 2759 9367360 <p>Immunization with hepatitis C virus core gene triggers potent T-cell response, but affects CD4+ T-cells</p> Isaguliants MG Petrakova NV Kashuba EV Suzdaltzeva YG Belikov SV Mokhonov VV Prilipov AG Matskova L Smirnova IS Jolivet-Reynaud C Nordenfelt E Vaccine 2004 22 1656 1665 10.1016/j.vaccine.2003.09.047 15068848 <p>Preparation of hepatitis C virus structural and non-structural protein fragments and studies of their immunogenicity</p> Mihailova M Fiedler M Boos M Petrovskis I Sominskaya I Roggendorf M Viazov S Pumpens P Protein Expr Purif 2006 50 43 48 10.1016/j.pep.2006.06.011 16889980 <p>[Preparation and purification of a polypeptide containing antigenic determinants of hepatitis C core protein]</p> Petrakova NV Kalinina TI Khudiakov I Gazina EV Smirnov VD Vopr Virusol 1997 42 208 212 9424844 <p>Properties of the hepatitis C virus core protein: a structural protein that modulates cellular processes</p> McLauchlan J J Viral Hepat 2000 7 2 14 10.1046/j.1365-2893.2000.00201.x 10718937 <p>The native form and maturation process of hepatitis C virus core protein</p> Yasui K Wakita T Tsukiyama-Kohara K Funahashi SI Ichikawa M Kajita T Moradpour D Wands JR Kohara M J Virol 1998 72 6048 6055 110410 9621068 <p>Intracellular localization of full-length and truncated hepatitis C virus core protein expressed in mammalian cells</p> Ravaggi A Natoli G Primi D Albertini A Levrero M Cariani E J Hepatol 1994 20 833 836 10.1016/S0168-8278(05)80157-6 7930486 <p>Nuclear localization of the truncated hepatitis C virus core protein with its hydrophobic C terminus deleted</p> Suzuki R Matsuura Y Suzuki T Ando A Chiba J Harada S Saito I Miyamura T J Gen Virol 1995 76 Pt 1 53 61 10.1099/0022-1317-76-1-53 7844542 <p>TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties</p> Mosmann TR Coffman RL Annu Rev Immunol 1989 7 145 173 10.1146/annurev.iy.07.040189.001045 2523712 <p>DNA-vaccination via tattooing induces stronger humoral and cellular immune responses than intramuscular delivery supported by molecular adjuvants</p> Pokorna D Rubio I Muller M Genet Vaccines Ther 2008 6 4 2267179 18257910 10.1186/1479-0556-6-4 <p>The hepatitis C virus: identification, epidemiology, and clinical controversies</p> Nowicki MJ Balistreri WF J Pediatr Gastroenterol Nutr 1995 20 248 274 7608821 <p>DNA vaccines: improving expression of antigens</p> Garmory HS Brown KA Titball RW Genet Vaccines Ther 2003 1 2 244903 14606963 10.1186/1479-0556-1-2 <p>A Nonviral Cytoplasmic T7 Autogene System and Its Applications in DNA Vaccination</p> Sturtz FG Li Y Shulok J Snodgrass HR Chen Xz 2000 323 333 <p>Multiple effects of codon usage optimization on expression and immunogenicity of DNA candidate vaccines encoding the human immunodeficiency virus type 1 Gag protein</p> Deml L Bojak A Steck S Graf M Wild J Schirmbeck R Wolf H Wagner R J Virol 2001 75 10991 11001 114679 11602739 10.1128/JVI.75.22.10991-11001.2001 <p>Influence of codon usage on the immunogenicity of a DNA vaccine against tetanus</p> Stratford R Douce G Zhang-Barber L Fairweather N Eskola J Dougan G Vaccine 2000 19 810 815 10.1016/S0264-410X(00)00246-2 11115703 <p>Dose dependence of CTL precursor frequency induced by a DNA vaccine and correlation with protective immunity against influenza virus challenge</p> Fu TM Guan L Friedman A Schofield TL Ulmer JB Liu MA Donnelly JJ J Immunol 1999 162 4163 4170 10201942 <p>Comparison of various expression plasmids for the induction of immune response by DNA immunization</p> Lee AH Suh YS Sung JH Yang SH Sung YC Mol Cells 1997 7 495 501 9339893 <p>Viral persistence, antibody to E1 and E2, and hypervariable region 1 sequence stability in hepatitis C virus-inoculated chimpanzees</p> Bassett SE Thomas DL Brasky KM Lanford RE J Virol 1999 73 1118 1126 103932 9882313 <p>Immunology of hepatitis B virus and hepatitis C virus infection</p> Rehermann B Nascimbeni M Nat Rev Immunol 2005 5 215 229 10.1038/nri1573 15738952 <p>Role of ATP in binding and migration of 40S ribosomal subunits</p> Kozak M Cell 1980 22 459 467 10.1016/0092-8674(80)90356-6 7448869 <p>Point mutations close to the AUG initiator codon affect the efficiency of translation of rat preproinsulin in vivo</p> Kozak M Nature 1984 308 241 246 10.1038/308241a0 6700727 <p>Alternative mechanisms of initiating translation of mammalian mRNAs</p> Jackson RJ Biochem Soc Trans 2005 33 1231 1241 10.1042/BST20051282 16246087 <p>Structural and mechanistic insights into hepatitis C viral translation initiation</p> Fraser CS Doudna JA Nat Rev Microbiol 2007 5 29 38 10.1038/nrmicro1558 17128284 <p>Amino acids 1–20 of the hepatitis C virus (HCV) core protein specifically inhibit HCV IRES-dependent translation in HepG2 cells, and inhibit both HCV</p> Li D Takyar ST Lott WB Gowans EJ J Gen Virol 2003 84 815 825 10.1099/vir.0.18697-0 12655082 <p>Core protein-coding sequence, but not core protein, modulates the efficiency of cap-independent translation directed by the internal ribosome entry site of hepatitis C virus</p> Wang TH Rijnbrand RC Lemon SM J Virol 2000 74 11347 11358 113240 11070035 10.1128/JVI.74.23.11347-11358.2000 <p>DNA inoculation induces protective in vivo immune responses against cellular challenge with HIV-1 antigen-expressing cells</p> Wang B Merva M Dang K Ugen KE Boyer J Williams WV Weiner DB AIDS Res Hum Retroviruses 1994 10 Suppl 2 S35 S41 7865331 <p>Heterologous protection against influenza by injection of DNA encoding a viral protein</p> Ulmer JB Donnelly JJ Parker SE Rhodes GH Felgner PL Dwarki VJ Gromkowski SH Deck RR DeWitt CM Friedman A Science 1993 259 1745 1749 10.1126/science.8456302 8456302 <p>Multi-subtype gp160 DNA immunization induces broadly neutralizing anti-HIV antibodies</p> Rollman E Hinkula J Arteaga J Zuber B Kjerrstrom A Liu M Wahren B Ljungberg K Gene Ther 2004 11 1146 1154 10.1038/sj.gt.3302275 15103320 <p>A single immunization with a rhabdovirus-based vector expressing severe acute respiratory syndrome coronavirus (SARS-CoV) S protein results in the production of high levels of SARS-CoV-neutralizing antibodies</p> Faber M Lamirande EW Roberts A Rice AB Koprowski H Dietzschold B Schnell MJ J Gen Virol 2005 86 1435 1440 1361274 15831955 10.1099/vir.0.80844-0 <p>Field trials of a very potent rabies DNA vaccine which induced long lasting virus neutralizing antibodies and protection in dogs in experimental conditions</p> Bahloul C Taieb D Diouani MF Ahmed SB Chtourou Y B'chir BI Kharmachi H Dellagi K Vaccine 2006 24 1063 1072 10.1016/j.vaccine.2005.09.016 16213633 <p>Gene immunization may induce secondary antibodies reacting with DNA</p> Isaguliants MG Iakimtchouk K Petrakova NV Yermalovich MA Zuber AK Kashuba VI Belikov SV Andersson S Kochetkov SN Klinman DM Wahren B Vaccine 2004 22 1576 1585 10.1016/j.vaccine.2003.09.033 15063584 <p>"Bacterialized" gene for the C-terminus Truncated Version of Human Hepatitis C virus Core Induces Potent Th2-type Immune Response in Mice</p> Petrakova N Yakimchuk K Suzdaltzeva Y Jolivet-Reynaud C Wahren B Isaguliants MG [Abstract] DNA Vaccine Conference, Monte-Carlo, Monaco 17–19 November, 2004 <p>Interactions of single and combined human immunodeficiency virus type 1 (HIV-1) DNA vaccines</p> Kjerrstrom A Hinkula J Engstrom G Ovod V Krohn K Benthin R Wahren B Virology 2001 284 46 61 10.1006/viro.2001.0905 11352667 <p>Pulmonary necrosis resulting from DNA vaccination against tuberculosis</p> Taylor JL Turner OC Basaraba RJ Belisle JT Huygen K Orme IM Infect Immun 2003 71 2192 2198 152079 12654841 10.1128/IAI.71.4.2192-2198.2003 <p>Lack of protection in mice and necrotizing bronchointerstitial pneumonia with bronchiolitis in guinea pigs immunized with vaccines directed against the hsp60 molecule of Mycobacterium tuberculosis</p> Turner OC Roberts AD Frank AA Phalen SW McMurray DM Content J Denis O D'Souza S Tanghe A Huygen K Orme IM Infect Immun 2000 68 3674 3679 97658 10816527 10.1128/IAI.68.6.3674-3679.2000 <p>Transcriptional regulation of cellular and viral promoters by the hepatitis C virus core protein</p> Ray RB Lagging LM Meyer K Steele R Ray R Virus Res 1995 37 209 220 10.1016/0168-1702(95)00034-N 8533458 <p>Cellular response to conditional expression of hepatitis C virus core protein in Huh7 cultured human hepatoma cells</p> Li K Prow T Lemon SM Beard MR Hepatology 2002 35 1237 1246 10.1053/jhep.2002.32968 11981774 <p>Oxidative stress in the absence of inflammation in a mouse model for hepatitis C virus-associated hepatocarcinogenesis</p> Moriya K Nakagawa K Santa T Shintani Y Fujie H Miyoshi H Tsutsumi T Miyazawa T Ishibashi K Horie T Imai K Todoroki T Kimura S Koike K Cancer Res 2001 61 4365 4370 11389061 <p>The HCV core protein acts as a positive regulator of fas-mediated apoptosis in a human lymphoblastoid T cell line</p> Hahn CS Cho YG Kang BS Lester IM Hahn YS Virology 2000 276 127 137 10.1006/viro.2000.0541 11022001 <p>Suppression of apoptotic cell death by hepatitis C virus core protein</p> Ray RB Meyer K Ray R Virology 1996 226 176 182 10.1006/viro.1996.0644 8955036 <p>The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice</p> Moriya K Fujie H Shintani Y Yotsuyanagi H Tsutsumi T Ishibashi K Matsuura Y Kimura S Miyamura T Koike K Nat Med 1998 4 1065 1067 10.1038/2053 9734402 <p>Hepatitis C virus core protein cooperates with ras and transforms primary rat embryo fibroblasts to tumorigenic phenotype</p> Ray RB Lagging LM Meyer K Ray R J Virol 1996 70 4438 4443 190377 8676467 <p>Hepatitis C virus core protein modulates fatty acid metabolism and thereby causes lipid accumulation in the liver</p> Yamaguchi A Tazuma S Nishioka T Ohishi W Hyogo H Nomura S Chayama K Dig Dis Sci 2005 50 1361 1371 10.1007/s10620-005-2788-1 16047488 <p>Hepatitis C virus core protein induces hepatic steatosis in transgenic mice</p> Moriya K Yotsuyanagi H Shintani Y Fujie H Ishibashi K Matsuura Y Miyamura T Koike K J Gen Virol 1997 78 Pt 7 1527 1531 9225025 <p>The prime-boost strategy: exciting prospects for improved vaccination</p> Ramshaw IA Ramsay AJ Immunol Today 2000 21 163 165 10.1016/S0167-5699(00)01612-1 10740236